Incidental Mutation 'R5240:Pth'
ID400725
Institutional Source Beutler Lab
Gene Symbol Pth
Ensembl Gene ENSMUSG00000059077
Gene Nameparathyroid hormone
Synonyms
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113385580-113388570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113385844 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 107 (D107E)
Ref Sequence ENSEMBL: ENSMUSP00000078723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079793]
Predicted Effect probably damaging
Transcript: ENSMUST00000079793
AA Change: D107E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078723
Gene: ENSMUSG00000059077
AA Change: D107E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PTH 30 65 7.55e-20 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parathyroid family of proteins. The encoded preproprotein is proteolytically processed to generate a protein that binds to the parathyroid hormone/parathyroid hormone-related peptide receptor and regulates blood calcium and phosphate levels. Excess production of the encoded protein, known as hyperparathyroidism, can result in hypercalcemia and kidney stones. On the other hand, defective processing of the encoded protein may lead to hypoparathyroidism, which can result in hypocalcemia and numbness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit diminished cartilage mineralization, and reductions in angiopoietin-1, neovascularization, metaphyseal osteoblasts, and trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Pth
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2884:Pth UTSW 7 113386028 missense probably damaging 1.00
R2964:Pth UTSW 7 113385929 missense probably benign 0.00
R2965:Pth UTSW 7 113385929 missense probably benign 0.00
R2966:Pth UTSW 7 113385929 missense probably benign 0.00
R4650:Pth UTSW 7 113385819 makesense probably null
R7606:Pth UTSW 7 113386243 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CACTGCTTACTTGATTCATGAGC -3'
(R):5'- CTCCATGGAGAGGATGCAATGG -3'

Sequencing Primer
(F):5'- TTGAAATGGAATCATTGAAAGAGACC -3'
(R):5'- CAATGGCTGAGAAGGAAGCTGC -3'
Posted On2016-07-06