Mutagenetix > Incidental Mutations

Incidental Mutation 'R5240:Pls1'

400735

Institutional Source

Beutler Lab

Gene Symbol

Pls1

Ensembl Gene

ENSMUSG00000049493

Gene Name

plastin 1 (I-isoform)

Synonyms

I-fimbrin

MMRRC Submission

042811-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R5240 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95752642-95845311 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 95776622 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093800]

Predicted Effect

probably null
Transcript: ENSMUST00000093800

SMART Domains

Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493

Domain	Start	End	E-Value	Type
EFh	15	43	8.5e-5	SMART
EFh	55	83	1.73e-5	SMART
low complexity region	100	116	N/A	INTRINSIC
CH	124	236	3.69e-23	SMART
CH	268	375	4.4e-21	SMART
CH	398	503	7.27e-22	SMART
CH	519	624	3.75e-15	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdc42bpg	T	G	19: 6,315,899	L786R	probably damaging	Het
Cfap73	C	T	5: 120,629,707	V260I	probably damaging	Het
Chchd10	A	T	10: 75,937,449	N131I	probably damaging	Het
Chn2	T	C	6: 54,220,695	V190A	probably benign	Het
Clec2l	C	T	6: 38,673,452	T64I	probably damaging	Het
Cpeb3	T	A	19: 37,174,515	T154S	probably damaging	Het
D130043K22Rik	A	G	13: 24,877,977	E643G	probably damaging	Het
Ddx31	A	G	2: 28,846,030	M127V	probably benign	Het
Dennd1b	A	G	1: 139,062,877	Y193C	probably damaging	Het
Dgke	T	A	11: 89,050,685	D288V	probably damaging	Het
Dst	T	A	1: 34,208,558	L1683*	probably null	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
E130116L18Rik	G	T	5: 25,223,020		probably benign	Het
Eif2b5	G	A	16: 20,501,398	V115I	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fgfr3	A	T	5: 33,730,038	T234S	probably damaging	Het
Gipc2	A	T	3: 152,102,662	D251E	possibly damaging	Het
Gm11787	A	C	4: 3,511,810		noncoding transcript	Het
Gm5538	A	C	3: 59,752,028	T301P	probably damaging	Het
Haus6	A	G	4: 86,583,178	Y819H	possibly damaging	Het
Homez	G	A	14: 54,858,074	A59V	probably damaging	Het
Iffo1	T	C	6: 125,152,460	V363A	probably benign	Het
Ifit2	T	A	19: 34,574,396	D445E	probably benign	Het
Ipo9	A	C	1: 135,389,606		probably benign	Het
Kcnv1	C	T	15: 45,113,244	G216R	probably damaging	Het
Kdm6b	A	C	11: 69,401,904		probably benign	Het
Mplkip	T	C	13: 17,695,719	S79P	probably damaging	Het
Nae1	T	C	8: 104,523,144		probably benign	Het
Nfe2l2	A	T	2: 75,676,009	N582K	possibly damaging	Het
Nsmce4a	G	A	7: 130,537,024	R297C	probably damaging	Het
Olfr397	T	C	11: 73,964,806	L66P	probably damaging	Het
Olfr411	T	A	11: 74,347,242	D114V	probably damaging	Het
Olfr495	A	T	7: 108,395,702	D194V	probably damaging	Het
Osbp	T	A	19: 11,978,290	F357I	probably damaging	Het
Pcdhb4	A	G	18: 37,309,926	D763G	possibly damaging	Het
Pcdhgb2	A	C	18: 37,691,050	I365L	possibly damaging	Het
Pde6g	A	G	11: 120,448,086		probably benign	Het
Pigo	C	A	4: 43,020,675	V756L	possibly damaging	Het
Pkhd1	G	T	1: 20,275,641	T2721K	probably benign	Het
Prim2	A	G	1: 33,480,316		probably benign	Het
Prkd2	T	A	7: 16,855,786	I471N	probably benign	Het
Prrc2b	C	T	2: 32,206,396	T593I	probably benign	Het
Ptch2	C	A	4: 117,106,138		probably benign	Het
Pth	A	T	7: 113,385,844	D107E	probably damaging	Het
Pycr2	A	C	1: 180,907,623	Q315P	probably benign	Het
Rbpj	A	T	5: 53,649,440	Y209F	probably damaging	Het
Ripk4	C	A	16: 97,743,767	R560L	probably damaging	Het
Sdr42e1	T	C	8: 117,663,282	R207G	probably benign	Het
Sipa1l1	A	G	12: 82,341,588	Y196C	possibly damaging	Het
Smarcc2	T	C	10: 128,481,006		probably null	Het
Stom	T	A	2: 35,336,877	I15F	probably benign	Het
Sugp2	G	T	8: 70,243,275	L299F	probably benign	Het
Tbrg4	A	T	11: 6,617,516		probably null	Het
Tkt	G	T	14: 30,565,678	G210C	probably damaging	Het
Tmem163	G	A	1: 127,491,552		probably benign	Het
Trip12	A	G	1: 84,794,133	I98T	probably benign	Het
Unc5b	A	G	10: 60,774,640	I466T	probably damaging	Het
Unc79	T	A	12: 103,070,751	F599L	probably damaging	Het
Vav1	G	A	17: 57,297,122	E151K	probably damaging	Het
Vcan	T	G	13: 89,692,532	D1631A	probably benign	Het
Vmn2r4	A	C	3: 64,406,937	S208A	possibly damaging	Het
Zfp619	A	G	7: 39,537,218	T891A	possibly damaging	Het
Zfp672	A	G	11: 58,329,701		probably benign	Het
Znhit1	T	A	5: 136,982,381		probably null	Het

Other mutations in Pls1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pls1	APN	9	95782419	missense	possibly damaging	0.95
IGL00836:Pls1	APN	9	95761422	missense	possibly damaging	0.86
IGL01391:Pls1	APN	9	95773698	missense	probably benign	0.38
IGL02335:Pls1	APN	9	95784183	missense	probably benign	0.32
IGL02875:Pls1	APN	9	95754351	missense	possibly damaging	0.93
IGL03081:Pls1	APN	9	95773643	missense	probably damaging	1.00
IGL03271:Pls1	APN	9	95776830	missense	probably benign	0.04
PIT4585001:Pls1	UTSW	9	95761390	missense	probably benign
R0048:Pls1	UTSW	9	95787063	missense	probably damaging	1.00
R0088:Pls1	UTSW	9	95795768	missense	possibly damaging	0.93
R0409:Pls1	UTSW	9	95786919	splice site	probably benign
R2015:Pls1	UTSW	9	95761365	missense	possibly damaging	0.77
R2516:Pls1	UTSW	9	95776563	missense	probably benign	0.00
R2985:Pls1	UTSW	9	95785582	missense	possibly damaging	0.73
R3964:Pls1	UTSW	9	95785612	missense	probably benign	0.00
R3965:Pls1	UTSW	9	95785612	missense	probably benign	0.00
R5681:Pls1	UTSW	9	95787012	missense	probably damaging	1.00
R6399:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6441:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6496:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6498:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6499:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R7016:Pls1	UTSW	9	95786941	missense	probably damaging	1.00
R7177:Pls1	UTSW	9	95773559	missense	probably benign	0.01
R7458:Pls1	UTSW	9	95785507	missense	probably damaging	1.00
R7467:Pls1	UTSW	9	95769113	missense	possibly damaging	0.78
R7536:Pls1	UTSW	9	95762057	missense	probably damaging	1.00
R7553:Pls1	UTSW	9	95787087	missense	probably damaging	1.00
R7691:Pls1	UTSW	9	95773673	missense	probably benign	0.21
R7756:Pls1	UTSW	9	95776844	missense	probably benign	0.44
R7758:Pls1	UTSW	9	95776844	missense	probably benign	0.44
R7876:Pls1	UTSW	9	95785505	nonsense	probably null
R8269:Pls1	UTSW	9	95761970	missense	probably damaging	1.00
R8380:Pls1	UTSW	9	95775385	missense	probably benign	0.03
Z1177:Pls1	UTSW	9	95754387	missense	probably damaging	0.99
Z1177:Pls1	UTSW	9	95785618	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AAAACTCTCCACCTTGATGTCC -3'
(R):5'- AGGAAAATCTGAACCTAGCACTG -3'

Sequencing Primer
(F):5'- CACCTTGATGTCCTGGCTGAAG -3'
(R):5'- GTCAACATTGGTGCTCAGGAC -3'

Posted On

2016-07-06