Incidental Mutation 'R5200:Pten'
ID400736
Institutional Source Beutler Lab
Gene Symbol Pten
Ensembl Gene ENSMUSG00000013663
Gene Namephosphatase and tensin homolog
SynonymsA130070J02Rik, 2310035O07Rik, B430203M17Rik, MMAC1, TEP1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location32757497-32826160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32799891 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 95 (P95L)
Ref Sequence ENSEMBL: ENSMUSP00000013807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013807]
Predicted Effect probably damaging
Transcript: ENSMUST00000013807
AA Change: P95L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000013807
Gene: ENSMUSG00000013663
AA Change: P95L

DomainStartEndE-ValueType
Pfam:Y_phosphatase 42 183 2.7e-6 PFAM
Pfam:DSPc 67 173 2.4e-9 PFAM
PTEN_C2 188 349 4.07e-49 SMART
low complexity region 360 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140014
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a phosphatase with dual activity against phospholipids and proteins, and acts as a tumor-suppressor. The protein contains four structural domains, a PIP2-binding domain, a catalytic tensin-type phosphatase domain, a C2 tensin-type domain and a PDZ-binding domain. The protein belongs to the protein tyrosine phosphatase family. Deletion of this gene in mice contribute to tumorigenesis in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die by E9.5 with abnormally patterned enlarged brains and defective placentas. Heterozygotes develop a range of neoplasms. Conditional mutants demonstrate effects on basic processes of proliferation, differentiation and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Pten
AlleleSourceChrCoordTypePredicted EffectPPH Score
Brakes UTSW 19 32815497 missense probably benign
Bremse UTSW 19 32800085 missense possibly damaging 0.91
R0131:Pten UTSW 19 32776069 missense probably benign 0.15
R0557:Pten UTSW 19 32817890 missense probably benign
R1387:Pten UTSW 19 32798096 missense probably benign
R1479:Pten UTSW 19 32819850 missense probably damaging 0.99
R1773:Pten UTSW 19 32798072 missense probably damaging 1.00
R4801:Pten UTSW 19 32758503 missense possibly damaging 0.75
R4802:Pten UTSW 19 32758503 missense possibly damaging 0.75
R5196:Pten UTSW 19 32815497 missense probably benign
R5672:Pten UTSW 19 32758466 missense probably benign
R6143:Pten UTSW 19 32800085 missense possibly damaging 0.91
R7644:Pten UTSW 19 32811834 missense probably damaging 1.00
R7849:Pten UTSW 19 32799996 missense probably damaging 1.00
R7867:Pten UTSW 19 32815494 missense probably benign
R7932:Pten UTSW 19 32799996 missense probably damaging 1.00
R7950:Pten UTSW 19 32815494 missense probably benign
Z1088:Pten UTSW 19 32776051 missense probably damaging 0.96
Z1088:Pten UTSW 19 32799998 missense probably damaging 1.00
Z1176:Pten UTSW 19 32798115 critical splice donor site probably null
Z1177:Pten UTSW 19 32811805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGTTTCCATGTCTAATGAATGC -3'
(R):5'- AAATCTAGGGCCTCTTGTGCC -3'

Sequencing Primer
(F):5'- AGGCTTCTTTTAAGAACCAG -3'
(R):5'- GTGCCTTTAAAAATTTGCCCCGATG -3'
Posted On2016-07-06