Incidental Mutation 'R5201:Taf3'
ID400746
Institutional Source Beutler Lab
Gene Symbol Taf3
Ensembl Gene ENSMUSG00000025782
Gene NameTATA-box binding protein associated factor 3
SynonymsmTAFII140, 4933439M23Rik
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location9914552-10048596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9952184 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 391 (S391P)
Ref Sequence ENSEMBL: ENSMUSP00000026888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]
PDB Structure
Solution structure of the free TAF3 PHD domain [SOLUTION NMR]
Solution structure of the TAF3 PHD domain in complex with a H3K4me3 peptide [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000026888
AA Change: S391P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: S391P

DomainStartEndE-ValueType
BTP 3 79 1.94e-34 SMART
low complexity region 159 173 N/A INTRINSIC
low complexity region 237 253 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
coiled coil region 519 572 N/A INTRINSIC
coiled coil region 611 651 N/A INTRINSIC
coiled coil region 692 751 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
low complexity region 795 821 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
PHD 869 915 4.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114909
AA Change: S238P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: S238P

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 334 352 N/A INTRINSIC
coiled coil region 366 419 N/A INTRINSIC
coiled coil region 458 498 N/A INTRINSIC
coiled coil region 539 598 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 642 668 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
PHD 716 762 4.77e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Taf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Taf3 APN 2 9952917 missense probably damaging 1.00
IGL01620:Taf3 APN 2 9952661 missense probably benign 0.00
IGL02084:Taf3 APN 2 10042519 missense probably benign 0.08
IGL02229:Taf3 APN 2 9952834 missense probably damaging 1.00
IGL02891:Taf3 APN 2 9921227 missense probably damaging 1.00
IGL03173:Taf3 APN 2 9952927 missense probably damaging 0.99
IGL03302:Taf3 APN 2 9952131 missense probably damaging 1.00
Howard UTSW 2 9951160 missense probably damaging 0.99
R0344:Taf3 UTSW 2 9951898 missense probably benign 0.05
R0348:Taf3 UTSW 2 10042644 missense probably benign 0.05
R0506:Taf3 UTSW 2 9940993 missense probably benign 0.00
R1724:Taf3 UTSW 2 9952366 missense probably benign 0.01
R2151:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2154:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2495:Taf3 UTSW 2 9952833 missense probably damaging 1.00
R3702:Taf3 UTSW 2 9952561 missense possibly damaging 0.74
R3739:Taf3 UTSW 2 9951658 missense possibly damaging 0.89
R3921:Taf3 UTSW 2 10048298 missense probably benign 0.06
R4097:Taf3 UTSW 2 9952367 missense possibly damaging 0.54
R4602:Taf3 UTSW 2 9952657 missense probably damaging 0.96
R4615:Taf3 UTSW 2 9952090 missense probably damaging 1.00
R4679:Taf3 UTSW 2 10048564 utr 5 prime probably benign
R4789:Taf3 UTSW 2 9951959 missense probably damaging 1.00
R4801:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R4802:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R5522:Taf3 UTSW 2 9941005 missense probably damaging 1.00
R5629:Taf3 UTSW 2 9918178 missense probably damaging 1.00
R6427:Taf3 UTSW 2 9951353 missense probably damaging 0.98
R6492:Taf3 UTSW 2 9951160 missense probably damaging 0.99
R6804:Taf3 UTSW 2 9918217 missense possibly damaging 0.91
R7282:Taf3 UTSW 2 9951442 missense probably damaging 0.96
R7293:Taf3 UTSW 2 9952090 missense probably damaging 0.98
R7368:Taf3 UTSW 2 9916377 missense unknown
R7637:Taf3 UTSW 2 9940993 missense probably benign 0.00
R7686:Taf3 UTSW 2 9951488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGAGGTTCCGCTGGAG -3'
(R):5'- TTGTAGCTCATGTTCCCCAAAC -3'

Sequencing Primer
(F):5'- TTCCGCTGGAGAGAGGCAG -3'
(R):5'- ATGTTCCCCAAACCCCTGTCAG -3'
Posted On2016-07-06