Incidental Mutation 'R5201:Surf4'
ID400749
Institutional Source Beutler Lab
Gene Symbol Surf4
Ensembl Gene ENSMUSG00000014867
Gene Namesurfeit gene 4
SynonymsSurf-4
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5201 (G1)
Quality Score199
Status Not validated
Chromosome2
Chromosomal Location26920040-26933928 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 26933766 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015011] [ENSMUST00000055406] [ENSMUST00000153641] [ENSMUST00000153771]
Predicted Effect probably benign
Transcript: ENSMUST00000015011
SMART Domains Protein: ENSMUSP00000015011
Gene: ENSMUSG00000014867

DomainStartEndE-ValueType
Pfam:SURF4 4 269 5.7e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055406
SMART Domains Protein: ENSMUSP00000062967
Gene: ENSMUSG00000049897

DomainStartEndE-ValueType
Pfam:Pkinase 3 266 8e-35 PFAM
Pfam:Pkinase_Tyr 7 262 4.5e-27 PFAM
low complexity region 352 366 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153641
SMART Domains Protein: ENSMUSP00000124720
Gene: ENSMUSG00000014867

DomainStartEndE-ValueType
Pfam:SURF4 4 82 1.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153771
SMART Domains Protein: ENSMUSP00000121332
Gene: ENSMUSG00000049897

DomainStartEndE-ValueType
Pfam:Pkinase 4 116 2.3e-8 PFAM
Pfam:Pkinase_Tyr 6 115 4.6e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154651
AA Change: V5A
SMART Domains Protein: ENSMUSP00000125327
Gene: ENSMUSG00000014867
AA Change: V5A

DomainStartEndE-ValueType
Pfam:SURF4 16 124 2e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Surf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02626:Surf4 APN 2 26925607 critical splice donor site probably null
R1448:Surf4 UTSW 2 26924464 missense probably damaging 1.00
R1538:Surf4 UTSW 2 26933698 splice site probably null
R5635:Surf4 UTSW 2 26933313 missense probably benign 0.11
R6249:Surf4 UTSW 2 26926887 missense probably damaging 1.00
R7413:Surf4 UTSW 2 26924443 missense probably benign 0.03
RF024:Surf4 UTSW 2 26922167 missense probably benign 0.07
X0024:Surf4 UTSW 2 26926802 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGTCGTTCTGTCCCATG -3'
(R):5'- AGCATGCTCGGTAGTGACTG -3'

Sequencing Primer
(F):5'- GGCCAAGCCTTAAAGGGACC -3'
(R):5'- TAGTGACTGCTCCGTGTGCC -3'
Posted On2016-07-06