Incidental Mutation 'R5240:Olfr411'
ID400751
Institutional Source Beutler Lab
Gene Symbol Olfr411
Ensembl Gene ENSMUSG00000054406
Gene Nameolfactory receptor 411
SynonymsMOR255-3, GA_x6K02T2P1NL-4481525-4480578
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74345129-74352650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74347242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 114 (D114V)
Ref Sequence ENSEMBL: ENSMUSP00000149978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080365] [ENSMUST00000141134] [ENSMUST00000214769]
Predicted Effect probably damaging
Transcript: ENSMUST00000080365
AA Change: D114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079235
Gene: ENSMUSG00000054406
AA Change: D114V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-58 PFAM
Pfam:7tm_1 44 293 8.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141134
Predicted Effect probably damaging
Transcript: ENSMUST00000214769
AA Change: D114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Olfr411
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr411 APN 11 74347429 missense probably benign 0.00
IGL01308:Olfr411 APN 11 74346660 missense probably damaging 1.00
IGL01596:Olfr411 APN 11 74347419 missense possibly damaging 0.79
IGL02233:Olfr411 APN 11 74347428 missense possibly damaging 0.51
IGL03407:Olfr411 APN 11 74347545 missense possibly damaging 0.47
R0371:Olfr411 UTSW 11 74346934 missense probably damaging 0.99
R0924:Olfr411 UTSW 11 74346798 missense probably damaging 1.00
R0926:Olfr411 UTSW 11 74347306 missense probably benign 0.00
R1265:Olfr411 UTSW 11 74346940 missense probably benign 0.00
R3712:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4446:Olfr411 UTSW 11 74346762 missense probably benign 0.12
R4669:Olfr411 UTSW 11 74346963 missense probably benign
R4851:Olfr411 UTSW 11 74346943 missense probably benign
R4990:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4992:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R5130:Olfr411 UTSW 11 74347167 missense probably damaging 1.00
R5171:Olfr411 UTSW 11 74346814 missense probably benign 0.08
R5346:Olfr411 UTSW 11 74346670 missense probably benign 0.00
R5491:Olfr411 UTSW 11 74346914 missense probably benign 0.07
R5723:Olfr411 UTSW 11 74347128 missense possibly damaging 0.66
R6581:Olfr411 UTSW 11 74347206 missense probably damaging 0.98
R7561:Olfr411 UTSW 11 74347610 intron probably benign
Z1177:Olfr411 UTSW 11 74347480 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATTGATCACATTGGGGCCG -3'
(R):5'- CAACCTAAGCATCCTGGCAG -3'

Sequencing Primer
(F):5'- CCGCAGAAGTTAAGTGTGGATATG -3'
(R):5'- CAGCTGTATTTGTGGAACCCAAACTC -3'
Posted On2016-07-06