Incidental Mutation 'R5201:Tpd52l2'
ID400759
Institutional Source Beutler Lab
Gene Symbol Tpd52l2
Ensembl Gene ENSMUSG00000000827
Gene Nametumor protein D52-like 2
SynonymsD54, 2810411G23Rik
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181497142-181517966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181515086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 172 (V172I)
Ref Sequence ENSEMBL: ENSMUSP00000068888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000844] [ENSMUST00000069712] [ENSMUST00000108799] [ENSMUST00000108800] [ENSMUST00000149163] [ENSMUST00000184588] [ENSMUST00000184849]
Predicted Effect probably benign
Transcript: ENSMUST00000000844
AA Change: V178I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000844
Gene: ENSMUSG00000000827
AA Change: V178I

DomainStartEndE-ValueType
Pfam:TPD52 28 199 6.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069712
AA Change: V172I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068888
Gene: ENSMUSG00000000827
AA Change: V172I

DomainStartEndE-ValueType
Pfam:TPD52 27 193 5.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108799
AA Change: V201I

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104427
Gene: ENSMUSG00000000827
AA Change: V201I

DomainStartEndE-ValueType
Pfam:TPD52 18 121 1.9e-38 PFAM
Pfam:TPD52 115 220 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108800
AA Change: V158I

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104428
Gene: ENSMUSG00000000827
AA Change: V158I

DomainStartEndE-ValueType
Pfam:TPD52 27 179 2.9e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130261
Predicted Effect probably benign
Transcript: ENSMUST00000141825
SMART Domains Protein: ENSMUSP00000123627
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 12 161 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149163
AA Change: V192I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117690
Gene: ENSMUSG00000000827
AA Change: V192I

DomainStartEndE-ValueType
Pfam:TPD52 28 213 5.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157753
Predicted Effect probably benign
Transcript: ENSMUST00000184588
Predicted Effect probably benign
Transcript: ENSMUST00000184849
AA Change: V157I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138837
Gene: ENSMUSG00000000827
AA Change: V157I

DomainStartEndE-ValueType
Pfam:TPD52 9 170 2.4e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor protein D52-like family. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. Expression of this gene may be a marker for breast cancer and acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Aug 2011]
PHENOTYPE: Female mice homozygous for a knock-out allele exhibit decreased body length and absent or minimal hepatic lipidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Tpd52l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tpd52l2 APN 2 181513068 missense probably damaging 1.00
IGL00593:Tpd52l2 APN 2 181499896 missense probably damaging 1.00
IGL02475:Tpd52l2 APN 2 181499874 missense probably benign 0.11
IGL03394:Tpd52l2 APN 2 181515086 missense probably benign 0.39
PIT4791001:Tpd52l2 UTSW 2 181499888 missense probably benign 0.02
R0276:Tpd52l2 UTSW 2 181502059 splice site probably null
R0615:Tpd52l2 UTSW 2 181501951 missense probably damaging 1.00
R4910:Tpd52l2 UTSW 2 181515212 unclassified probably benign
R5527:Tpd52l2 UTSW 2 181502054 critical splice donor site probably null
R5806:Tpd52l2 UTSW 2 181502887 missense probably damaging 1.00
R5809:Tpd52l2 UTSW 2 181511579 missense probably damaging 1.00
R5839:Tpd52l2 UTSW 2 181499898 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCGACCAAAATGGGTGATTCTTG -3'
(R):5'- TCTGCATGAACATGGGTATGAC -3'

Sequencing Primer
(F):5'- TGGAGAACCTATCCAGACTGTGTC -3'
(R):5'- GGGTATGACTGTCTTCAAAACCAGC -3'
Posted On2016-07-06