Incidental Mutation 'R5240:D130043K22Rik'
ID 400762
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5240 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24877977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 643 (E643G)
Ref Sequence ENSEMBL: ENSMUSP00000116004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably damaging
Transcript: ENSMUST00000006893
AA Change: E643G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: E643G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141572
AA Change: E643G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: E643G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169411
Meta Mutation Damage Score 0.3991 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGTGCTAATGGCTGTG -3'
(R):5'- GCTGTTTAATGCAATCCTCCAGG -3'

Sequencing Primer
(F):5'- GAATTGAACCCAGGTCCTCTG -3'
(R):5'- TCCTCCAGGGAAGGGGTG -3'
Posted On 2016-07-06