Mutagenetix > Incidental Mutation

Incidental Mutation 'R5240:D130043K22Rik'

400762

Institutional Source

Beutler Lab

Gene Symbol

D130043K22Rik

Ensembl Gene

ENSMUSG00000006711

Gene Name

RIKEN cDNA D130043K22 gene

Synonyms

MMRRC Submission

042811-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5240 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24845135-24901270 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24877977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 643 (E643G)

Ref Sequence

ENSEMBL: ENSMUSP00000116004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]

AlphaFold

Q5SZV5

Predicted Effect

probably damaging
Transcript: ENSMUST00000006893
AA Change: E643G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: E643G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	3e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART
FN3	728	808	9.15e1	SMART
PKD	729	820	4.38e-10	SMART
transmembrane domain	965	987	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000141572
AA Change: E643G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: E643G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	2e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169411

Meta Mutation Damage Score

0.3991

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdc42bpg	T	G	19: 6,315,899	L786R	probably damaging	Het
Cfap73	C	T	5: 120,629,707	V260I	probably damaging	Het
Chchd10	A	T	10: 75,937,449	N131I	probably damaging	Het
Chn2	T	C	6: 54,220,695	V190A	probably benign	Het
Clec2l	C	T	6: 38,673,452	T64I	probably damaging	Het
Cpeb3	T	A	19: 37,174,515	T154S	probably damaging	Het
Ddx31	A	G	2: 28,846,030	M127V	probably benign	Het
Dennd1b	A	G	1: 139,062,877	Y193C	probably damaging	Het
Dgke	T	A	11: 89,050,685	D288V	probably damaging	Het
Dst	T	A	1: 34,208,558	L1683*	probably null	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
E130116L18Rik	G	T	5: 25,223,020		probably benign	Het
Eif2b5	G	A	16: 20,501,398	V115I	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fgfr3	A	T	5: 33,730,038	T234S	probably damaging	Het
Gipc2	A	T	3: 152,102,662	D251E	possibly damaging	Het
Gm11787	A	C	4: 3,511,810		noncoding transcript	Het
Gm5538	A	C	3: 59,752,028	T301P	probably damaging	Het
Haus6	A	G	4: 86,583,178	Y819H	possibly damaging	Het
Homez	G	A	14: 54,858,074	A59V	probably damaging	Het
Iffo1	T	C	6: 125,152,460	V363A	probably benign	Het
Ifit2	T	A	19: 34,574,396	D445E	probably benign	Het
Ipo9	A	C	1: 135,389,606		probably benign	Het
Kcnv1	C	T	15: 45,113,244	G216R	probably damaging	Het
Kdm6b	A	C	11: 69,401,904		probably benign	Het
Mplkip	T	C	13: 17,695,719	S79P	probably damaging	Het
Nae1	T	C	8: 104,523,144		probably benign	Het
Nfe2l2	A	T	2: 75,676,009	N582K	possibly damaging	Het
Nsmce4a	G	A	7: 130,537,024	R297C	probably damaging	Het
Olfr397	T	C	11: 73,964,806	L66P	probably damaging	Het
Olfr411	T	A	11: 74,347,242	D114V	probably damaging	Het
Olfr495	A	T	7: 108,395,702	D194V	probably damaging	Het
Osbp	T	A	19: 11,978,290	F357I	probably damaging	Het
Pcdhb4	A	G	18: 37,309,926	D763G	possibly damaging	Het
Pcdhgb2	A	C	18: 37,691,050	I365L	possibly damaging	Het
Pde6g	A	G	11: 120,448,086		probably benign	Het
Pigo	C	A	4: 43,020,675	V756L	possibly damaging	Het
Pkhd1	G	T	1: 20,275,641	T2721K	probably benign	Het
Pls1	A	T	9: 95,776,622		probably null	Het
Prim2	A	G	1: 33,480,316		probably benign	Het
Prkd2	T	A	7: 16,855,786	I471N	probably benign	Het
Prrc2b	C	T	2: 32,206,396	T593I	probably benign	Het
Ptch2	C	A	4: 117,106,138		probably benign	Het
Pth	A	T	7: 113,385,844	D107E	probably damaging	Het
Pycr2	A	C	1: 180,907,623	Q315P	probably benign	Het
Rbpj	A	T	5: 53,649,440	Y209F	probably damaging	Het
Ripk4	C	A	16: 97,743,767	R560L	probably damaging	Het
Sdr42e1	T	C	8: 117,663,282	R207G	probably benign	Het
Sipa1l1	A	G	12: 82,341,588	Y196C	possibly damaging	Het
Smarcc2	T	C	10: 128,481,006		probably null	Het
Stom	T	A	2: 35,336,877	I15F	probably benign	Het
Sugp2	G	T	8: 70,243,275	L299F	probably benign	Het
Tbrg4	A	T	11: 6,617,516		probably null	Het
Tkt	G	T	14: 30,565,678	G210C	probably damaging	Het
Tmem163	G	A	1: 127,491,552		probably benign	Het
Trip12	A	G	1: 84,794,133	I98T	probably benign	Het
Unc5b	A	G	10: 60,774,640	I466T	probably damaging	Het
Unc79	T	A	12: 103,070,751	F599L	probably damaging	Het
Vav1	G	A	17: 57,297,122	E151K	probably damaging	Het
Vcan	T	G	13: 89,692,532	D1631A	probably benign	Het
Vmn2r4	A	C	3: 64,406,937	S208A	possibly damaging	Het
Zfp619	A	G	7: 39,537,218	T891A	possibly damaging	Het
Zfp672	A	G	11: 58,329,701		probably benign	Het
Znhit1	T	A	5: 136,982,381		probably null	Het

Other mutations in D130043K22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:D130043K22Rik	APN	13	24867174	missense	probably damaging	1.00
IGL01114:D130043K22Rik	APN	13	24857156	missense	probably damaging	0.99
IGL01412:D130043K22Rik	APN	13	24887860	missense	probably damaging	1.00
IGL01542:D130043K22Rik	APN	13	24876037	splice site	probably null
IGL01615:D130043K22Rik	APN	13	24899796	missense	probably damaging	1.00
IGL01705:D130043K22Rik	APN	13	24857941	missense	probably benign	0.00
IGL02220:D130043K22Rik	APN	13	24883755	missense	possibly damaging	0.95
IGL02229:D130043K22Rik	APN	13	24875924	missense	probably damaging	1.00
IGL02576:D130043K22Rik	APN	13	24856870	missense	possibly damaging	0.74
IGL03038:D130043K22Rik	APN	13	24879619	missense	probably damaging	1.00
IGL03117:D130043K22Rik	APN	13	24889842	missense	probably damaging	1.00
IGL03014:D130043K22Rik	UTSW	13	24858092	missense	possibly damaging	0.88
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0020:D130043K22Rik	UTSW	13	24854492	utr 5 prime	probably benign
R0172:D130043K22Rik	UTSW	13	24872406	missense	probably benign	0.16
R0276:D130043K22Rik	UTSW	13	24858045	missense	possibly damaging	0.92
R0304:D130043K22Rik	UTSW	13	24864815	missense	probably benign	0.07
R0335:D130043K22Rik	UTSW	13	24887877	missense	probably damaging	0.98
R0744:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0833:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0836:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R1270:D130043K22Rik	UTSW	13	24857338	missense	probably benign	0.00
R1433:D130043K22Rik	UTSW	13	24871341	missense	probably damaging	1.00
R1682:D130043K22Rik	UTSW	13	24882556	missense	probably damaging	1.00
R1772:D130043K22Rik	UTSW	13	24875999	missense	probably damaging	1.00
R1773:D130043K22Rik	UTSW	13	24882602	missense	possibly damaging	0.80
R1800:D130043K22Rik	UTSW	13	24883894	missense	probably damaging	1.00
R1956:D130043K22Rik	UTSW	13	24885595	missense	probably damaging	1.00
R2255:D130043K22Rik	UTSW	13	24856911	missense	probably damaging	1.00
R2445:D130043K22Rik	UTSW	13	24857036	missense	probably benign	0.04
R2568:D130043K22Rik	UTSW	13	24883891	missense	probably damaging	0.97
R4160:D130043K22Rik	UTSW	13	24862696	missense	probably benign	0.02
R4494:D130043K22Rik	UTSW	13	24871356	missense	probably benign	0.16
R4732:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4733:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4782:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4799:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4864:D130043K22Rik	UTSW	13	24863612	missense	probably damaging	1.00
R5155:D130043K22Rik	UTSW	13	24872290	missense	probably damaging	1.00
R5383:D130043K22Rik	UTSW	13	24857414	missense	probably benign	0.02
R5493:D130043K22Rik	UTSW	13	24863603	missense	probably damaging	1.00
R6184:D130043K22Rik	UTSW	13	24885591	missense	probably damaging	1.00
R6305:D130043K22Rik	UTSW	13	24885685	missense	probably damaging	1.00
R6436:D130043K22Rik	UTSW	13	24877935	missense	probably damaging	1.00
R6980:D130043K22Rik	UTSW	13	24864781	missense	probably damaging	0.98
R7038:D130043K22Rik	UTSW	13	24893408	missense	probably damaging	1.00
R7085:D130043K22Rik	UTSW	13	24872302	missense	possibly damaging	0.95
R7147:D130043K22Rik	UTSW	13	24882563	missense	probably benign	0.31
R7384:D130043K22Rik	UTSW	13	24882605	missense	probably damaging	1.00
R7398:D130043K22Rik	UTSW	13	24893377	missense	probably damaging	0.97
R7584:D130043K22Rik	UTSW	13	24872370	missense	probably damaging	1.00
R7585:D130043K22Rik	UTSW	13	24885585	missense	probably benign	0.01
R7588:D130043K22Rik	UTSW	13	24887893	missense	probably damaging	0.99
R7610:D130043K22Rik	UTSW	13	24876002	missense	probably benign	0.30
R7903:D130043K22Rik	UTSW	13	24876012	missense	probably damaging	0.98
R7966:D130043K22Rik	UTSW	13	24893423	missense	probably damaging	1.00
R8014:D130043K22Rik	UTSW	13	24856702	missense	probably damaging	1.00
R8374:D130043K22Rik	UTSW	13	24857979	missense	probably benign	0.07
R8543:D130043K22Rik	UTSW	13	24889869	missense	probably benign	0.08
R8775:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8775-TAIL:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8806:D130043K22Rik	UTSW	13	24899635	missense	probably benign	0.11
R8916:D130043K22Rik	UTSW	13	24872271	missense	probably benign
R9209:D130043K22Rik	UTSW	13	24857107	missense	possibly damaging	0.96
R9524:D130043K22Rik	UTSW	13	24887893	missense	possibly damaging	0.89
Z1177:D130043K22Rik	UTSW	13	24856709	missense	probably damaging	1.00
Z1177:D130043K22Rik	UTSW	13	24856834	missense	probably benign	0.39
Z1177:D130043K22Rik	UTSW	13	24872248	missense	possibly damaging	0.79
Z1177:D130043K22Rik	UTSW	13	24880847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCAGTGCTAATGGCTGTG -3'
(R):5'- GCTGTTTAATGCAATCCTCCAGG -3'

Sequencing Primer
(F):5'- GAATTGAACCCAGGTCCTCTG -3'
(R):5'- TCCTCCAGGGAAGGGGTG -3'

Posted On

2016-07-06