Incidental Mutation 'R5201:Plekhn1'
ID400771
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Namepleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156221456-156234857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 156230527 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 558 (V558L)
Ref Sequence ENSEMBL: ENSMUSP00000101194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105569
AA Change: V558L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485
AA Change: V558L

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184043
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156222408 missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156223856 critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156223649 missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156224940 nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156224811 missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156228246 missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156228323 splice site probably benign
R0540:Plekhn1 UTSW 4 156222747 missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156225201 missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156225364 missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156228263 missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156223564 critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156222381 missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156221882 missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156222701 missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156222659 missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156225594 missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156225533 missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156225669 missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156224750 missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156224693 unclassified probably null
R4176:Plekhn1 UTSW 4 156221801 missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156225356 missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156225273 splice site probably null
R4477:Plekhn1 UTSW 4 156223399 missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156222424 missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156224765 missense possibly damaging 0.93
R5896:Plekhn1 UTSW 4 156223874 missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156222695 missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156225239 missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156230558 synonymous probably null
R6263:Plekhn1 UTSW 4 156225193 critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156221804 missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156224793 missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156224569 missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156221792 missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156233917 missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156223335 missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156222671 missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156233961 missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156230685 missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156233314 missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156224820 missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156225653 missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156232234 missense probably damaging 1.00
R8065:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
R8067:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
X0023:Plekhn1 UTSW 4 156222354 missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156224915 critical splice donor site probably null
Z1176:Plekhn1 UTSW 4 156223431 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CCAAATGAGTGGGGCACA -3'
(R):5'- GCCTCCAGCCTGTCCTATTG -3'

Sequencing Primer
(F):5'- TAACCATAGGGACAGGGCAAC -3'
(R):5'- GTCTCTACAGGTGAATTCATGGACAC -3'
Posted On2016-07-06