Incidental Mutation 'R5201:Drd5'
ID400775
Institutional Source Beutler Lab
Gene Symbol Drd5
Ensembl Gene ENSMUSG00000039358
Gene Namedopamine receptor D5
SynonymsD5R, Gpcr1, Drd1b, Drd-5, DRD1b
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38319367-38322518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38320023 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 120 (M120L)
Ref Sequence ENSEMBL: ENSMUSP00000039691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041646]
Predicted Effect probably damaging
Transcript: ENSMUST00000041646
AA Change: M120L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039691
Gene: ENSMUSG00000039358
AA Change: M120L

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 47 177 5.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 49 179 1e-7 PFAM
Pfam:7tm_1 55 354 1.5e-74 PFAM
Pfam:7TM_GPCR_Srsx 210 368 2.4e-6 PFAM
low complexity region 419 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181240
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop hypertension and exhibit elevated blood pressure caused by increased sympathetic tone. Mice homozygous for another knock-out allele exhibit increased methamphetamine-induced ambulatory activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Drd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Drd5 APN 5 38319781 missense probably benign 0.25
PIT4305001:Drd5 UTSW 5 38320584 missense probably damaging 1.00
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0571:Drd5 UTSW 5 38319927 missense probably damaging 1.00
R1507:Drd5 UTSW 5 38320722 missense probably damaging 1.00
R1663:Drd5 UTSW 5 38320855 missense probably benign 0.02
R1777:Drd5 UTSW 5 38320161 missense probably damaging 1.00
R1932:Drd5 UTSW 5 38319976 missense probably benign 0.14
R1986:Drd5 UTSW 5 38320113 missense probably damaging 0.99
R2047:Drd5 UTSW 5 38320336 missense probably damaging 1.00
R3875:Drd5 UTSW 5 38319814 missense possibly damaging 0.84
R5033:Drd5 UTSW 5 38320201 missense probably damaging 1.00
R5255:Drd5 UTSW 5 38319967 missense probably damaging 1.00
R5393:Drd5 UTSW 5 38320905 missense probably benign
R5639:Drd5 UTSW 5 38319835 missense possibly damaging 0.81
R7241:Drd5 UTSW 5 38320536 missense probably damaging 1.00
R7520:Drd5 UTSW 5 38320852 missense probably benign 0.00
R7739:Drd5 UTSW 5 38320078 missense probably damaging 1.00
Z1177:Drd5 UTSW 5 38320386 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AATCGTCTGGACCTTGCTCG -3'
(R):5'- CCTTGTCTCTGTGCCAATTGAG -3'

Sequencing Primer
(F):5'- CAACGTCCTAGTGTGTGCTGC -3'
(R):5'- TTGAGTTGGACCGGGATAAAG -3'
Posted On2016-07-06