Incidental Mutation 'R5240:Pcdhgb2'
ID400779
Institutional Source Beutler Lab
Gene Symbol Pcdhgb2
Ensembl Gene ENSMUSG00000102748
Gene Nameprotocadherin gamma subfamily B, 2
Synonyms
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37689828-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37691050 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 365 (I365L)
Ref Sequence ENSEMBL: ENSMUSP00000141449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193631
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000195112
AA Change: I365L

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748
AA Change: I365L

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195624
Meta Mutation Damage Score 0.2646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Pcdhgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2906:Pcdhgb2 UTSW 18 37690855 missense probably damaging 1.00
R3081:Pcdhgb2 UTSW 18 37691513 missense probably damaging 1.00
R3780:Pcdhgb2 UTSW 18 37691757 missense probably damaging 1.00
R4095:Pcdhgb2 UTSW 18 37690950 missense probably benign 0.01
R4258:Pcdhgb2 UTSW 18 37692049 missense probably damaging 1.00
R4261:Pcdhgb2 UTSW 18 37691897 missense probably damaging 1.00
R4695:Pcdhgb2 UTSW 18 37692322 missense probably benign 0.00
R4741:Pcdhgb2 UTSW 18 37691684 unclassified probably null
R4824:Pcdhgb2 UTSW 18 37690449 missense probably damaging 1.00
R4852:Pcdhgb2 UTSW 18 37692050 missense probably damaging 1.00
R4858:Pcdhgb2 UTSW 18 37692100 missense probably benign 0.22
R4933:Pcdhgb2 UTSW 18 37692214 missense probably benign 0.07
R5791:Pcdhgb2 UTSW 18 37692340 missense possibly damaging 0.92
R5973:Pcdhgb2 UTSW 18 37690507 missense probably benign 0.00
R6059:Pcdhgb2 UTSW 18 37690025 nonsense probably null
R6217:Pcdhgb2 UTSW 18 37690001 missense possibly damaging 0.71
R6903:Pcdhgb2 UTSW 18 37692170 missense possibly damaging 0.94
R6953:Pcdhgb2 UTSW 18 37690754 missense possibly damaging 0.95
R7150:Pcdhgb2 UTSW 18 37692247 missense possibly damaging 0.89
R7214:Pcdhgb2 UTSW 18 37690106 missense probably damaging 1.00
R7453:Pcdhgb2 UTSW 18 37691015 missense probably damaging 0.96
R7728:Pcdhgb2 UTSW 18 37691207 missense probably damaging 1.00
R7754:Pcdhgb2 UTSW 18 37689970 missense probably benign 0.23
R7846:Pcdhgb2 UTSW 18 37692220 missense possibly damaging 0.88
R7929:Pcdhgb2 UTSW 18 37692220 missense possibly damaging 0.88
R8001:Pcdhgb2 UTSW 18 37690634 missense probably benign 0.06
Z1177:Pcdhgb2 UTSW 18 37692148 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGAGACAGCTAAGAGTTACAC -3'
(R):5'- ACCGGTGCATTGTCGTTGAC -3'

Sequencing Primer
(F):5'- GCTAAGAGTTACACCCTGAATGTAG -3'
(R):5'- CTATCGGCAGCTACAATGGTGAC -3'
Posted On2016-07-06