Incidental Mutation 'R5240:Cdc42bpg'
ID400783
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6315899 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 786 (L786R)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: L786R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: L786R

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Meta Mutation Damage Score 0.8343 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R7986:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGAGATCCGTGCCAAG -3'
(R):5'- CACCTCAGTAAGATACGGGTG -3'

Sequencing Primer
(F):5'- AGATCCGTGCCAAGCAGAGTC -3'
(R):5'- ACCCAGCAGTGTTCAGTGAG -3'
Posted On2016-07-06