Incidental Mutation 'R5201:Dyrk1b'
ID400791
Institutional Source Beutler Lab
Gene Symbol Dyrk1b
Ensembl Gene ENSMUSG00000002409
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
SynonymsMirk
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28179469-28187294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28185096 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 279 (Y279C)
Ref Sequence ENSEMBL: ENSMUSP00000133719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]
Predicted Effect probably damaging
Transcript: ENSMUST00000085901
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172467
AA Change: Y339C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: Y339C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172761
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173223
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133364
Gene: ENSMUSG00000002409
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Dyrk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dyrk1b APN 7 28182676 missense probably damaging 0.96
IGL01820:Dyrk1b APN 7 28181600 utr 5 prime probably benign
IGL03155:Dyrk1b APN 7 28182687 missense probably benign 0.25
R0280:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R0323:Dyrk1b UTSW 7 28185356 missense probably benign 0.00
R0610:Dyrk1b UTSW 7 28186634 missense probably damaging 0.99
R0765:Dyrk1b UTSW 7 28185711 intron probably benign
R1858:Dyrk1b UTSW 7 28182646 unclassified probably null
R2354:Dyrk1b UTSW 7 28185372 missense possibly damaging 0.79
R4599:Dyrk1b UTSW 7 28182431 missense probably damaging 1.00
R4655:Dyrk1b UTSW 7 28185751 missense probably damaging 0.97
R5357:Dyrk1b UTSW 7 28185318 missense possibly damaging 0.79
R5560:Dyrk1b UTSW 7 28184253 missense possibly damaging 0.53
R6171:Dyrk1b UTSW 7 28186550 critical splice acceptor site probably null
R6751:Dyrk1b UTSW 7 28186709 missense probably damaging 1.00
R6901:Dyrk1b UTSW 7 28185117 missense probably damaging 1.00
R6918:Dyrk1b UTSW 7 28185925 missense probably damaging 0.99
R7699:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R7700:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
X0060:Dyrk1b UTSW 7 28183150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATGGGCAGGACAGTGTTG -3'
(R):5'- CTCCACAATACGGCTCATCTGG -3'

Sequencing Primer
(F):5'- CAGGACAGTGTTGGTGGC -3'
(R):5'- AATACGGCTCATCTGGTCCAC -3'
Posted On2016-07-06