Incidental Mutation 'R5241:Adgrb3'
ID400792
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 042812-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R5241 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25111790 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 881 (T881A)
Ref Sequence ENSEMBL: ENSMUSP00000116759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably benign
Transcript: ENSMUST00000041838
AA Change: T1121A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: T1121A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126096
Predicted Effect probably benign
Transcript: ENSMUST00000126626
AA Change: T251A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: T251A

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135518
AA Change: T1121A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: T1121A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146592
AA Change: T881A

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: T881A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151309
AA Change: T1121A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: T1121A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153568
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930033H14Rik A G 10: 69,212,751 probably null Het
Adgrv1 A T 13: 81,488,929 C3464* probably null Het
Afp A G 5: 90,501,614 M347V probably benign Het
Apc2 A G 10: 80,312,234 T1041A probably benign Het
Atl1 T C 12: 69,959,113 S398P possibly damaging Het
Atp8b4 G A 2: 126,383,726 P528L probably benign Het
Bahcc1 C A 11: 120,271,403 P176T probably damaging Het
Bsnd A G 4: 106,487,985 V88A probably benign Het
Dnah7c T A 1: 46,530,500 F687Y probably benign Het
Dok6 T C 18: 89,598,789 I23M possibly damaging Het
Fcgbp A T 7: 28,085,199 D228V probably damaging Het
Gatad2a G A 8: 69,918,017 Q107* probably null Het
Glis3 G T 19: 28,350,023 T663K probably benign Het
Gm10784 T A 13: 49,945,093 noncoding transcript Het
Gsdmc2 C T 15: 63,824,894 R476H probably benign Het
Gsdmc3 A G 15: 63,864,146 S202P possibly damaging Het
Map3k8 T C 18: 4,340,750 E188G probably damaging Het
Mccc1 T A 3: 35,974,196 Q487L probably benign Het
Msantd1 A G 5: 34,921,469 D116G probably damaging Het
Myh1 T A 11: 67,204,449 S212T probably benign Het
Nr1h4 A G 10: 89,483,489 Y158H probably damaging Het
Olfr1180 T C 2: 88,412,098 T187A possibly damaging Het
Olfr421-ps1 T A 1: 174,152,101 I195N probably benign Het
Olfr585 T C 7: 103,098,317 V192A probably benign Het
Pcnt A T 10: 76,433,617 H272Q probably benign Het
Pdia5 T C 16: 35,429,775 N242S probably benign Het
Pkd1l2 A T 8: 117,035,118 D1441E probably damaging Het
Runx2 G T 17: 44,639,777 Y203* probably null Het
Sdr9c7 T G 10: 127,909,790 I257S probably benign Het
Slitrk1 A G 14: 108,913,012 M89T probably benign Het
St14 G T 9: 31,100,418 C397* probably null Het
Tas2r123 T C 6: 132,847,218 I26T probably benign Het
Tmem144 A T 3: 79,814,124 M329K probably benign Het
Tmem252 T C 19: 24,674,127 M20T probably benign Het
Umodl1 T C 17: 30,984,092 V473A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Xirp2 C T 2: 67,482,360 R58* probably null Het
Zer1 A C 2: 30,104,970 L471R probably damaging Het
Zfp101 C T 17: 33,382,236 C182Y probably benign Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25098897 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25432544 missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25128834 missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25420556 critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25221757 splice site probably null
R8161:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25826516 missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25488053 missense probably benign 0.21
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25093914 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCCATTGTCAGTGGAGAAGATG -3'
(R):5'- ACACAAGAATGCTTTGTGGGAG -3'

Sequencing Primer
(F):5'- TCAGTGGAGAAGATGAACTTAGTCTG -3'
(R):5'- AATGCTTTGTGGGAGAGCGAG -3'
Posted On2016-07-06