Incidental Mutation 'R5201:Enpp6'
ID400801
Institutional Source Beutler Lab
Gene Symbol Enpp6
Ensembl Gene ENSMUSG00000038173
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms4833421B01Rik, D8Ertd514e, Npp6, B830047L21Rik
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location46986887-47096762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47065451 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 205 (Q205K)
Ref Sequence ENSEMBL: ENSMUSP00000112633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039840] [ENSMUST00000119686] [ENSMUST00000123066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039840
AA Change: Q205K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044608
Gene: ENSMUSG00000038173
AA Change: Q205K

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.3e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119686
AA Change: Q205K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112633
Gene: ENSMUSG00000038173
AA Change: Q205K

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.1e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123066
AA Change: Q205K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000149593
SMART Domains Protein: ENSMUSP00000121470
Gene: ENSMUSG00000038173

DomainStartEndE-ValueType
PDB:4LR2|A 2 74 2e-10 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleotide pyrophosphatase/phosphodiesterase family of enzymes that play an important role in regulating extracellular nucleotide metabolism. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol (GPI)-anchored membrane protein that hydrolyzes choline-containing lysophospholipids such as glycerophosphocholine. Mice lacking the encoded protein develop fatty liver and myelin sheath abnormalities. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Enpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Enpp6 APN 8 47065932 missense probably damaging 1.00
IGL02882:Enpp6 APN 8 47030532 missense probably damaging 1.00
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0331:Enpp6 UTSW 8 47082449 missense probably damaging 1.00
R0525:Enpp6 UTSW 8 47082443 missense possibly damaging 0.68
R1168:Enpp6 UTSW 8 47030454 missense probably damaging 0.96
R1295:Enpp6 UTSW 8 47065500 missense probably benign 0.00
R1533:Enpp6 UTSW 8 47065434 missense probably benign 0.02
R1923:Enpp6 UTSW 8 47082506 missense probably damaging 0.98
R2031:Enpp6 UTSW 8 47053614 missense probably damaging 0.99
R2090:Enpp6 UTSW 8 47065370 critical splice acceptor site probably null
R2656:Enpp6 UTSW 8 47082418 nonsense probably null
R3620:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3621:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3862:Enpp6 UTSW 8 47065992 missense probably benign 0.33
R4284:Enpp6 UTSW 8 47069015 missense probably damaging 1.00
R4592:Enpp6 UTSW 8 47093032 missense probably damaging 0.99
R4899:Enpp6 UTSW 8 46987083 missense probably damaging 1.00
R4963:Enpp6 UTSW 8 47065461 missense probably benign 0.30
R5322:Enpp6 UTSW 8 47068915 missense probably benign 0.06
R5933:Enpp6 UTSW 8 47066004 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCTCACACCTTCACAGAGGG -3'
(R):5'- ACCAAGGAGTCAGTTGGTGC -3'

Sequencing Primer
(F):5'- CAGAGGGTGAGTGGATCATG -3'
(R):5'- GCCTATGTGAAAAGTGCTCG -3'
Posted On2016-07-06