Mutagenetix > Incidental Mutation

Incidental Mutation 'R5201:Itgae'

400815

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

CD103, alpha-E1

MMRRC Submission

042776-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5201 (G1)

Quality Score

166

Status

Not validated

Chromosome

Chromosomal Location

73090583-73147446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73110556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 71 (R71Q)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably benign
Transcript: ENSMUST00000006101
AA Change: R71Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: R71Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102537
AA Change: R71Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: R71Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	C	A	15: 82,062,544	T214N	probably benign	Het
Actn4	A	T	7: 28,916,255		probably null	Het
Arap2	T	C	5: 62,683,489	E678G	probably damaging	Het
Atl2	T	C	17: 79,865,151	N130S	probably benign	Het
Ccdc129	T	C	6: 55,968,006	S571P	probably benign	Het
Cyp2b10	A	G	7: 25,916,994	D342G	probably damaging	Het
Dnah6	A	G	6: 73,195,732	Y248H	possibly damaging	Het
Drd5	A	T	5: 38,320,023	M120L	probably damaging	Het
Duox1	A	G	2: 122,327,922	R629G	probably benign	Het
Dyrk1b	A	G	7: 28,185,096	Y279C	probably damaging	Het
Efemp1	A	T	11: 28,914,590	I215L	probably benign	Het
Enpp6	C	A	8: 47,065,451	Q205K	probably damaging	Het
Fam170a	A	T	18: 50,282,126	T280S	probably benign	Het
Fam222a	G	A	5: 114,611,066	A108T	possibly damaging	Het
Fgd3	G	T	13: 49,296,378	P132T	probably benign	Het
Fzr1	A	T	10: 81,367,528	L399H	probably damaging	Het
Galnt15	G	A	14: 32,049,865	R289Q	probably damaging	Het
Hira	T	C	16: 18,952,115	V834A	probably damaging	Het
Ilf3	T	C	9: 21,389,383	L93P	probably damaging	Het
Kif14	T	A	1: 136,503,407	S1181T	probably benign	Het
Lrig3	C	A	10: 126,013,151	P946Q	possibly damaging	Het
Macf1	A	T	4: 123,475,945	C1674*	probably null	Het
Malt1	A	G	18: 65,476,055	K710R	probably benign	Het
Man1a2	A	T	3: 100,617,012	N373K	probably benign	Het
Mkl2	A	C	16: 13,401,592	T701P	probably benign	Het
Mpped2	A	G	2: 106,699,502	N32S	possibly damaging	Het
Myh10	A	T	11: 68,783,195	T652S	probably damaging	Het
Nfia	A	G	4: 98,111,225	Y485C	probably damaging	Het
Olfml2b	A	T	1: 170,668,864	T355S	probably benign	Het
Olfr1419	A	T	19: 11,870,631	I195K	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh1	A	T	18: 38,198,918	V344D	probably damaging	Het
Plekhn1	C	A	4: 156,230,527	V558L	probably benign	Het
Prr14l	A	G	5: 32,830,247	S635P	possibly damaging	Het
Prss46	T	A	9: 110,851,475	C229*	probably null	Het
Rad50	A	G	11: 53,698,820		probably null	Het
Slc27a3	A	T	3: 90,389,219	L191Q	probably benign	Het
Spert	A	G	14: 75,584,009	V101A	probably damaging	Het
Surf4	A	G	2: 26,933,766		probably benign	Het
Taf3	A	G	2: 9,952,184	S391P	probably damaging	Het
Tep1	A	C	14: 50,868,110	L151R	probably benign	Het
Tmprss11d	A	C	5: 86,309,355	N148K	possibly damaging	Het
Tpd52l2	G	A	2: 181,515,086	V172I	probably benign	Het
Vmn2r77	A	G	7: 86,811,638	D724G	probably damaging	Het
Wdr75	T	A	1: 45,823,359	D779E	probably benign	Het
Zfp943	A	T	17: 21,992,813	K293N	probably damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73145635	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73113694	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73123148	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73119437	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73119378	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73111759	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73116137	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73118184	missense	probably benign	0.29
IGL02149:Itgae	APN	11	73103894	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73134018	missense	probably benign	0.06
IGL02231:Itgae	APN	11	73090622	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73118535	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73118121	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73130951	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73118505	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73118203	splice site	probably benign
IGL02859:Itgae	APN	11	73114867	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73125310	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73113601	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73115574	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73133854	splice site	probably null
IGL03352:Itgae	APN	11	73131730	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73130999	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73118147	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73123183	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73114907	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73138509	nonsense	probably null
R1231:Itgae	UTSW	11	73119379	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73125362	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73115592	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73145605	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73117162	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73118643	splice site	probably benign
R1915:Itgae	UTSW	11	73118643	splice site	probably benign
R2061:Itgae	UTSW	11	73118622	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73145569	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73121937	nonsense	probably null
R2680:Itgae	UTSW	11	73114926	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73140687	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73113616	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73111339	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73112134	missense	probably benign
R4212:Itgae	UTSW	11	73119352	missense	probably benign
R4213:Itgae	UTSW	11	73119352	missense	probably benign
R4691:Itgae	UTSW	11	73119519	nonsense	probably null
R4736:Itgae	UTSW	11	73114880	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73130995	missense	probably damaging	1.00
R5307:Itgae	UTSW	11	73145638	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73111849	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73133908	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73129248	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73145551	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73140757	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73145601	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73131693	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73111402	splice site	probably null
R6502:Itgae	UTSW	11	73145592	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73118496	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73119516	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73111369	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73111358	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73140678	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73121960	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73113631	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73123269	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73138792	missense	probably benign
R7860:Itgae	UTSW	11	73120273	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73134087	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73120384	missense	probably benign
R8911:Itgae	UTSW	11	73113621	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73125263	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73121926	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73116080	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73111803	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73125356	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73120345	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73111376	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1186:Itgae	UTSW	11	73115640	missense	probably benign
Z1186:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1187:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73115640	missense	probably benign
Z1187:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1188:Itgae	UTSW	11	73115640	missense	probably benign
Z1188:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	73115640	missense	probably benign
Z1189:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1190:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73115640	missense	probably benign
Z1190:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	73115640	missense	probably benign
Z1191:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1192:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73115640	missense	probably benign
Z1192:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73134127	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- AGCTGTTTGTCATACCCAGGTC -3'
(R):5'- TGACAGTGGATAGCATGAGC -3'

Sequencing Primer
(F):5'- AGGTCTGGGCCTCTTCTTCAG -3'
(R):5'- TAGCATGAGCCTAGGCACTG -3'

Posted On

2016-07-06