Incidental Mutation 'R5201:Galnt15'
ID400819
Institutional Source Beutler Lab
Gene Symbol Galnt15
Ensembl Gene ENSMUSG00000021903
Gene Namepolypeptide N-acetylgalactosaminyltransferase 15
Synonyms
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32028989-32062197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32049865 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 289 (R289Q)
Ref Sequence ENSEMBL: ENSMUSP00000131978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022460] [ENSMUST00000164208]
Predicted Effect probably damaging
Transcript: ENSMUST00000022460
AA Change: R413Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022460
Gene: ENSMUSG00000021903
AA Change: R413Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 191 436 2e-8 PFAM
Pfam:Glycos_transf_2 194 362 9e-32 PFAM
RICIN 505 630 1.19e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164208
AA Change: R289Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131978
Gene: ENSMUSG00000021903
AA Change: R289Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
low complexity region 228 248 N/A INTRINSIC
RICIN 381 506 1.19e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Galnt15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Galnt15 APN 14 32052356 missense possibly damaging 0.47
IGL02491:Galnt15 APN 14 32056316 missense probably damaging 1.00
R0323:Galnt15 UTSW 14 32048085 missense probably damaging 0.99
R1900:Galnt15 UTSW 14 32049865 missense probably damaging 1.00
R4369:Galnt15 UTSW 14 32029539 missense possibly damaging 0.90
R4423:Galnt15 UTSW 14 32058269 missense possibly damaging 0.95
R4979:Galnt15 UTSW 14 32043290 missense probably damaging 0.99
R5093:Galnt15 UTSW 14 32049829 missense probably damaging 1.00
R5254:Galnt15 UTSW 14 32058287 nonsense probably null
R5434:Galnt15 UTSW 14 32049843 missense possibly damaging 0.88
R5451:Galnt15 UTSW 14 32029911 missense probably benign 0.25
R5495:Galnt15 UTSW 14 32029817 missense probably damaging 0.97
R5874:Galnt15 UTSW 14 32052367 missense probably damaging 1.00
R6374:Galnt15 UTSW 14 32058159 missense probably damaging 0.96
R6444:Galnt15 UTSW 14 32040411 missense probably damaging 1.00
R7798:Galnt15 UTSW 14 32029905 missense possibly damaging 0.52
Z1177:Galnt15 UTSW 14 32052365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAAACTCTCTGATCTGG -3'
(R):5'- GAATTCCAGGCAGAGGTCAACTG -3'

Sequencing Primer
(F):5'- ACTCTCTGATCTGGAAAGTGCAC -3'
(R):5'- ACCCTTATGTTGGCCAAAGG -3'
Posted On2016-07-06