Incidental Mutation 'R5201:Mkl2'
ID400827
Institutional Source Beutler Lab
Gene Symbol Mkl2
Ensembl Gene ENSMUSG00000009569
Gene NameMKL/myocardin-like 2
SynonymsGt4-1, MRTF-B, Mrtfb
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location13256481-13417529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13401592 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 701 (T701P)
Ref Sequence ENSEMBL: ENSMUSP00000122815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]
Predicted Effect probably benign
Transcript: ENSMUST00000009713
AA Change: T712P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: T712P

DomainStartEndE-ValueType
RPEL 51 76 9.67e-5 SMART
RPEL 95 120 2.22e-4 SMART
RPEL 139 164 1.56e-8 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
SAP 394 428 1.29e-8 SMART
low complexity region 495 510 N/A INTRINSIC
coiled coil region 552 601 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
low complexity region 699 722 N/A INTRINSIC
low complexity region 749 775 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1057 1074 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140892
Predicted Effect probably benign
Transcript: ENSMUST00000149359
AA Change: T701P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: T701P

DomainStartEndE-ValueType
RPEL 40 65 4.51e-5 SMART
RPEL 84 109 2.22e-4 SMART
RPEL 128 153 1.56e-8 SMART
low complexity region 206 219 N/A INTRINSIC
low complexity region 280 293 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
SAP 383 417 1.29e-8 SMART
low complexity region 484 499 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 688 711 N/A INTRINSIC
low complexity region 738 764 N/A INTRINSIC
low complexity region 831 843 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Mkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Mkl2 APN 16 13403222 missense probably benign 0.28
IGL00546:Mkl2 APN 16 13403225 missense possibly damaging 0.71
IGL01325:Mkl2 APN 16 13401224 missense probably damaging 1.00
IGL02125:Mkl2 APN 16 13400183 splice site probably null
IGL02803:Mkl2 APN 16 13403156 missense possibly damaging 0.94
IGL03143:Mkl2 APN 16 13400812 missense possibly damaging 0.46
IGL03180:Mkl2 APN 16 13398332 missense probably damaging 1.00
R0281:Mkl2 UTSW 16 13412163 missense probably damaging 0.99
R0505:Mkl2 UTSW 16 13412526 missense possibly damaging 0.80
R0540:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R0607:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R1073:Mkl2 UTSW 16 13412318 missense possibly damaging 0.89
R1423:Mkl2 UTSW 16 13412241 missense possibly damaging 0.96
R1432:Mkl2 UTSW 16 13401002 missense probably benign 0.01
R1459:Mkl2 UTSW 16 13401569 missense possibly damaging 0.93
R1693:Mkl2 UTSW 16 13398470 missense possibly damaging 0.67
R1693:Mkl2 UTSW 16 13398471 missense probably damaging 0.99
R2006:Mkl2 UTSW 16 13381576 nonsense probably null
R2076:Mkl2 UTSW 16 13401382 missense probably benign 0.01
R2125:Mkl2 UTSW 16 13400804 missense possibly damaging 0.94
R2145:Mkl2 UTSW 16 13412586 missense probably damaging 0.98
R3722:Mkl2 UTSW 16 13385693 missense probably damaging 1.00
R3883:Mkl2 UTSW 16 13401458 missense probably damaging 0.99
R4088:Mkl2 UTSW 16 13384200 missense probably damaging 0.98
R4204:Mkl2 UTSW 16 13403255 missense possibly damaging 0.88
R4301:Mkl2 UTSW 16 13398305 missense probably damaging 1.00
R4622:Mkl2 UTSW 16 13332706 missense probably damaging 1.00
R4633:Mkl2 UTSW 16 13379873 missense possibly damaging 0.95
R4765:Mkl2 UTSW 16 13412594 missense probably damaging 1.00
R5403:Mkl2 UTSW 16 13401013 missense probably damaging 0.97
R5725:Mkl2 UTSW 16 13384310 nonsense probably null
R6511:Mkl2 UTSW 16 13379850 missense probably damaging 1.00
R7207:Mkl2 UTSW 16 13326436 missense probably benign
R7269:Mkl2 UTSW 16 13401034 missense possibly damaging 0.48
R7311:Mkl2 UTSW 16 13405854 nonsense probably null
R7460:Mkl2 UTSW 16 13400976 missense probably benign 0.00
Z1177:Mkl2 UTSW 16 13385606 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGGATGAGGCCTCACTC -3'
(R):5'- GGCCTTCCAAAACTGTAGCC -3'

Sequencing Primer
(F):5'- AGTGCCTGGCCACTCTGTAG -3'
(R):5'- TGTAGCCCACAGTAGCTGCAC -3'
Posted On2016-07-06