Incidental Mutation 'R5201:Zfp943'
ID400832
Institutional Source Beutler Lab
Gene Symbol Zfp943
Ensembl Gene ENSMUSG00000053347
Gene Namezinc finger prtoein 943
Synonyms
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21962552-22071168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21992813 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 293 (K293N)
Ref Sequence ENSEMBL: ENSMUSP00000059554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055349] [ENSMUST00000153985] [ENSMUST00000174015]
Predicted Effect probably damaging
Transcript: ENSMUST00000055349
AA Change: K293N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059554
Gene: ENSMUSG00000053347
AA Change: K293N

DomainStartEndE-ValueType
KRAB 13 72 2.62e-18 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 236 258 1.13e-4 SMART
ZnF_C2H2 264 286 1.03e-2 SMART
ZnF_C2H2 292 314 2.24e-3 SMART
ZnF_C2H2 320 342 9.58e-3 SMART
ZnF_C2H2 348 370 5.67e-5 SMART
ZnF_C2H2 376 398 4.54e-4 SMART
ZnF_C2H2 404 426 2.15e-5 SMART
ZnF_C2H2 432 454 5.59e-4 SMART
ZnF_C2H2 460 482 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153985
SMART Domains Protein: ENSMUSP00000115817
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 73 3.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174015
SMART Domains Protein: ENSMUSP00000133735
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 60 3.79e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Other mutations in Zfp943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03101:Zfp943 APN 17 21992175 missense probably damaging 1.00
R0019:Zfp943 UTSW 17 21992089 intron probably benign
R0827:Zfp943 UTSW 17 21992090 critical splice acceptor site probably null
R1824:Zfp943 UTSW 17 21992380 missense probably benign 0.32
R1958:Zfp943 UTSW 17 21992998 missense probably damaging 0.99
R2174:Zfp943 UTSW 17 21992823 missense probably damaging 1.00
R3790:Zfp943 UTSW 17 21992422 missense possibly damaging 0.81
R4093:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4094:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4352:Zfp943 UTSW 17 21993123 missense probably damaging 0.98
R4677:Zfp943 UTSW 17 21993195 missense probably benign 0.17
R4735:Zfp943 UTSW 17 21992410 missense probably benign 0.03
R5492:Zfp943 UTSW 17 21993075 missense probably damaging 1.00
R5642:Zfp943 UTSW 17 21992832 missense probably damaging 1.00
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6667:Zfp943 UTSW 17 21992908 missense probably damaging 1.00
R6864:Zfp943 UTSW 17 21992612 missense probably damaging 1.00
R6976:Zfp943 UTSW 17 21990941 missense possibly damaging 0.47
R7837:Zfp943 UTSW 17 21992365 missense probably benign 0.39
R7920:Zfp943 UTSW 17 21992365 missense probably benign 0.39
Z1176:Zfp943 UTSW 17 21992965 missense probably damaging 1.00
Z1177:Zfp943 UTSW 17 21988082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCAAAGGAGACGTTATTATTCATG -3'
(R):5'- TCGCCTTTCTGAGTGAAACAT -3'

Sequencing Primer
(F):5'- GAATTCATACAGGAGAGAAACCTTAC -3'
(R):5'- GCCTTTCTGAGTGAAACATTTGTCAC -3'
Posted On2016-07-06