Incidental Mutation 'R5201:Atl2'
ID400834
Institutional Source Beutler Lab
Gene Symbol Atl2
Ensembl Gene ENSMUSG00000059811
Gene Nameatlastin GTPase 2
Synonyms2010110I21Rik, Aip-2, Arl6ip2
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location79848390-79896123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79865151 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 130 (N130S)
Ref Sequence ENSEMBL: ENSMUSP00000064758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068282] [ENSMUST00000112437] [ENSMUST00000222193]
Predicted Effect probably benign
Transcript: ENSMUST00000068282
AA Change: N130S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064758
Gene: ENSMUSG00000059811
AA Change: N130S

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Pfam:GBP 70 341 3.9e-105 PFAM
low complexity region 377 390 N/A INTRINSIC
Blast:HAMP 495 545 4e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112437
SMART Domains Protein: ENSMUSP00000108056
Gene: ENSMUSG00000059811

DomainStartEndE-ValueType
Pfam:GBP 1 170 6.6e-69 PFAM
Pfam:GBP_C 172 302 2.7e-8 PFAM
Blast:HAMP 324 374 3e-8 BLAST
Predicted Effect silent
Transcript: ENSMUST00000222193
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Atl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Atl2 APN 17 79859785 critical splice donor site probably null
IGL02692:Atl2 APN 17 79865053 missense probably benign
IGL03127:Atl2 APN 17 79852854 missense probably damaging 0.99
IGL03377:Atl2 APN 17 79865090 missense probably damaging 1.00
R0164:Atl2 UTSW 17 79853831 unclassified probably benign
R1203:Atl2 UTSW 17 79852905 missense probably damaging 0.99
R1489:Atl2 UTSW 17 79852706 missense probably benign 0.00
R1663:Atl2 UTSW 17 79864711 missense probably damaging 1.00
R1977:Atl2 UTSW 17 79852590 missense probably damaging 1.00
R2032:Atl2 UTSW 17 79895944 missense probably benign
R4063:Atl2 UTSW 17 79850159 makesense probably null
R5104:Atl2 UTSW 17 79852617 missense probably benign 0.01
R5362:Atl2 UTSW 17 79861461 missense probably damaging 1.00
R5387:Atl2 UTSW 17 79852800 missense probably benign 0.03
R6128:Atl2 UTSW 17 79865041 critical splice donor site probably null
R6369:Atl2 UTSW 17 79854555 missense probably damaging 0.96
R6416:Atl2 UTSW 17 79850223 missense probably benign 0.00
R6597:Atl2 UTSW 17 79852766 missense possibly damaging 0.68
R6885:Atl2 UTSW 17 79852553 missense probably damaging 1.00
R7428:Atl2 UTSW 17 79875798 splice site probably null
R7587:Atl2 UTSW 17 79865067 missense probably benign 0.25
R7646:Atl2 UTSW 17 79854607 missense probably damaging 1.00
R7781:Atl2 UTSW 17 79859831 missense probably damaging 1.00
X0052:Atl2 UTSW 17 79852617 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAGCCACCTAGGAATTCG -3'
(R):5'- TCTGTGTGACAAAGGCTGATTG -3'

Sequencing Primer
(F):5'- TTAGTAAAAGAATCACCAAAAATGCC -3'
(R):5'- GGCTGATTGGAGGAGACTG -3'
Posted On2016-07-06