Incidental Mutation 'R5241:Atl1'
ID 400843
Institutional Source Beutler Lab
Gene Symbol Atl1
Ensembl Gene ENSMUSG00000021066
Gene Name atlastin GTPase 1
Synonyms AD-FSP, Spg3a, FSP1, SPG3
MMRRC Submission 042812-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R5241 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 69892614-69966417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69959113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000021466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021466]
AlphaFold Q8BH66
Predicted Effect possibly damaging
Transcript: ENSMUST00000021466
AA Change: S398P

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: S398P

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:GBP 43 314 2.3e-103 PFAM
low complexity region 350 363 N/A INTRINSIC
Blast:HAMP 468 519 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110560
SMART Domains Protein: ENSMUSP00000106189
Gene: ENSMUSG00000079076

DomainStartEndE-ValueType
Pfam:TIP49 1 58 3.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222246
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930033H14Rik A G 10: 69,212,751 probably null Het
Adgrb3 T C 1: 25,111,790 T881A possibly damaging Het
Adgrv1 A T 13: 81,488,929 C3464* probably null Het
Afp A G 5: 90,501,614 M347V probably benign Het
Apc2 A G 10: 80,312,234 T1041A probably benign Het
Atp8b4 G A 2: 126,383,726 P528L probably benign Het
Bahcc1 C A 11: 120,271,403 P176T probably damaging Het
Bsnd A G 4: 106,487,985 V88A probably benign Het
Dnah7c T A 1: 46,530,500 F687Y probably benign Het
Dok6 T C 18: 89,598,789 I23M possibly damaging Het
Fcgbp A T 7: 28,085,199 D228V probably damaging Het
Gatad2a G A 8: 69,918,017 Q107* probably null Het
Glis3 G T 19: 28,350,023 T663K probably benign Het
Gm10784 T A 13: 49,945,093 noncoding transcript Het
Gsdmc2 C T 15: 63,824,894 R476H probably benign Het
Gsdmc3 A G 15: 63,864,146 S202P possibly damaging Het
Map3k8 T C 18: 4,340,750 E188G probably damaging Het
Mccc1 T A 3: 35,974,196 Q487L probably benign Het
Msantd1 A G 5: 34,921,469 D116G probably damaging Het
Myh1 T A 11: 67,204,449 S212T probably benign Het
Nr1h4 A G 10: 89,483,489 Y158H probably damaging Het
Olfr1180 T C 2: 88,412,098 T187A possibly damaging Het
Olfr421-ps1 T A 1: 174,152,101 I195N probably benign Het
Olfr585 T C 7: 103,098,317 V192A probably benign Het
Pcnt A T 10: 76,433,617 H272Q probably benign Het
Pdia5 T C 16: 35,429,775 N242S probably benign Het
Pkd1l2 A T 8: 117,035,118 D1441E probably damaging Het
Runx2 G T 17: 44,639,777 Y203* probably null Het
Sdr9c7 T G 10: 127,909,790 I257S probably benign Het
Slitrk1 A G 14: 108,913,012 M89T probably benign Het
St14 G T 9: 31,100,418 C397* probably null Het
Tas2r123 T C 6: 132,847,218 I26T probably benign Het
Tmem144 A T 3: 79,814,124 M329K probably benign Het
Tmem252 T C 19: 24,674,127 M20T probably benign Het
Umodl1 T C 17: 30,984,092 V473A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Xirp2 C T 2: 67,482,360 R58* probably null Het
Zer1 A C 2: 30,104,970 L471R probably damaging Het
Zfp101 C T 17: 33,382,236 C182Y probably benign Het
Other mutations in Atl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Atl1 APN 12 69932238 missense probably damaging 0.99
IGL02035:Atl1 APN 12 69960544 unclassified probably benign
IGL02229:Atl1 APN 12 69926025 missense probably benign 0.01
IGL03282:Atl1 APN 12 69954464 missense possibly damaging 0.87
IGL03374:Atl1 APN 12 69955367 missense probably damaging 1.00
R1538:Atl1 UTSW 12 69926188 missense probably benign 0.02
R1819:Atl1 UTSW 12 69963300 missense probably benign
R1903:Atl1 UTSW 12 69959275 missense probably damaging 0.98
R1961:Atl1 UTSW 12 69953500 missense probably benign 0.00
R1990:Atl1 UTSW 12 69963328 missense probably damaging 1.00
R2126:Atl1 UTSW 12 69931657 splice site probably null
R3724:Atl1 UTSW 12 69959380 missense probably damaging 0.99
R4402:Atl1 UTSW 12 69959199 missense probably benign 0.09
R5256:Atl1 UTSW 12 69959333 missense probably damaging 1.00
R5285:Atl1 UTSW 12 69954499 missense probably benign 0.18
R5866:Atl1 UTSW 12 69926011 missense probably damaging 0.98
R6001:Atl1 UTSW 12 69932283 missense possibly damaging 0.92
R6434:Atl1 UTSW 12 69959425 nonsense probably null
R6677:Atl1 UTSW 12 69953444 missense probably damaging 0.99
R6728:Atl1 UTSW 12 69947550 missense possibly damaging 0.95
R6974:Atl1 UTSW 12 69926039 missense probably damaging 0.99
R7013:Atl1 UTSW 12 69953440 missense probably damaging 1.00
R7121:Atl1 UTSW 12 69931634 missense probably damaging 0.99
R7224:Atl1 UTSW 12 69955353 missense probably benign
R7437:Atl1 UTSW 12 69931622 missense probably benign 0.37
R8043:Atl1 UTSW 12 69959215 missense probably damaging 1.00
R8319:Atl1 UTSW 12 69955319 missense probably damaging 0.99
R8843:Atl1 UTSW 12 69926148 missense probably damaging 0.98
Z1176:Atl1 UTSW 12 69937075 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AACACAGTTCTGGCTGCAG -3'
(R):5'- TGACAACGAACAGTGTGGC -3'

Sequencing Primer
(F):5'- GAAGTGTAGCCCACCCCTTAGTC -3'
(R):5'- CTGGGGTTCGAGCAGCATG -3'
Posted On 2016-07-06