Incidental Mutation 'R5202:Bfsp1'
ID400853
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Namebeaded filament structural protein 1, in lens-CP94
Synonymsfilensin
MMRRC Submission 042777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5202 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location143826528-143863173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143826971 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 569 (S569G)
Ref Sequence ENSEMBL: ENSMUSP00000096899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
Predicted Effect probably benign
Transcript: ENSMUST00000028907
AA Change: S563G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420
AA Change: S563G

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099296
AA Change: S569G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420
AA Change: S569G

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,731,964 M312L probably benign Het
Adam7 C A 14: 68,507,856 D640Y possibly damaging Het
Alcam T C 16: 52,274,236 Y384C probably damaging Het
Apob A G 12: 8,013,737 E289G probably damaging Het
Arhgap15 A T 2: 44,063,857 R198S probably benign Het
Bbs2 G T 8: 94,092,414 S109* probably null Het
Chst9 A T 18: 15,453,239 I89N probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Csde1 T G 3: 103,039,934 D67E probably damaging Het
Csf2rb T G 15: 78,349,057 S855A possibly damaging Het
Cyp4a10 T A 4: 115,532,615 D472E probably damaging Het
Cyp4f18 C A 8: 72,009,096 R49L probably benign Het
Daam1 G T 12: 71,944,274 V221L unknown Het
Dbr1 T G 9: 99,583,891 D507E probably benign Het
Dhrs7c A G 11: 67,815,801 M188V probably benign Het
Dicer1 A T 12: 104,694,731 L1688* probably null Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
E2f3 G A 13: 29,918,636 T91I probably damaging Het
Etaa1 A T 11: 17,947,853 V157E probably damaging Het
Foxp2 A T 6: 15,394,771 T157S probably benign Het
Frem2 A G 3: 53,551,346 V2034A probably benign Het
Fzd10 T C 5: 128,602,116 V300A possibly damaging Het
Gbf1 A T 19: 46,268,454 M778L probably benign Het
Gm17472 T A 6: 42,981,134 N112K probably benign Het
Gria4 T C 9: 4,424,330 K845R probably benign Het
Hspa4l T A 3: 40,781,569 S541T probably benign Het
Igkv4-68 G A 6: 69,304,942 R82C probably damaging Het
Itgb1 A T 8: 128,720,010 I383F probably damaging Het
Kcnk12 T A 17: 87,746,605 K210* probably null Het
Limch1 C G 5: 66,993,173 D163E probably damaging Het
Mbd4 A T 6: 115,849,402 D188E probably damaging Het
Myh9 C T 15: 77,781,110 probably null Het
Nbeal2 T C 9: 110,644,666 E28G probably damaging Het
Nfatc4 A G 14: 55,826,659 E201G probably damaging Het
Nrap G A 19: 56,335,151 H1330Y probably damaging Het
Nudt14 A G 12: 112,935,028 S151P probably damaging Het
Olfr297 C A 7: 86,527,116 R120S probably damaging Het
Olfr58 T A 9: 19,783,218 F28L possibly damaging Het
Olfr706 T A 7: 106,886,596 T74S possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr9 A G 9: 95,560,110 D51G probably damaging Het
Pcgf5 T A 19: 36,437,183 F80I probably damaging Het
Pkhd1 T G 1: 20,547,341 S1007R probably benign Het
Rab30 T C 7: 92,835,913 Y196H probably benign Het
Setd2 A T 9: 110,551,230 D1371V probably damaging Het
Slc48a1 A T 15: 97,790,700 I140F possibly damaging Het
Sorl1 A G 9: 42,033,583 V882A probably benign Het
Sptbn2 G T 19: 4,724,184 G88W probably damaging Het
Tdrd12 A G 7: 35,490,030 V427A possibly damaging Het
Tekt2 T C 4: 126,324,670 D69G probably benign Het
Tie1 C T 4: 118,480,510 V463I probably benign Het
Tmem150c G T 5: 100,079,954 H217N probably damaging Het
Tnks2 G A 19: 36,888,852 G1080R probably damaging Het
Ttll4 G A 1: 74,687,852 probably null Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143831892 missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143827644 splice site probably benign
IGL02329:Bfsp1 APN 2 143862646 missense probably benign
IGL02354:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143826736 missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143826933 missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143827333 missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143845968 missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143827643 splice site probably null
R0657:Bfsp1 UTSW 2 143827650 splice site probably benign
R1642:Bfsp1 UTSW 2 143841763 missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143841679 missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143862678 missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143827652 splice site probably null
R3024:Bfsp1 UTSW 2 143845959 missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143831829 splice site probably benign
R4914:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143862882 missense possibly damaging 0.81
R5267:Bfsp1 UTSW 2 143827051 missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143827291 missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143827459 missense probably benign 0.01
R6465:Bfsp1 UTSW 2 143858055 critical splice donor site probably null
R6888:Bfsp1 UTSW 2 143826719 missense probably benign 0.31
R7036:Bfsp1 UTSW 2 143826923 missense possibly damaging 0.65
R7075:Bfsp1 UTSW 2 143848965 missense probably damaging 1.00
R7362:Bfsp1 UTSW 2 143826875 missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143831835 critical splice donor site probably null
R7839:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
R7922:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143858117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGAAGTCTCTTCATATGTCTG -3'
(R):5'- CTATGCATCATGACGGCCAC -3'

Sequencing Primer
(F):5'- GAAATCTTCTCAATGGATTCCACC -3'
(R):5'- ACGTAGAGCCCTCTCCTG -3'
Posted On2016-07-06