Incidental Mutation 'R5202:Hspa4l'
ID 400855
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 042777-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R5202 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40736001 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 541 (S541T)
Ref Sequence ENSEMBL: ENSMUSP00000103721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably benign
Transcript: ENSMUST00000108086
AA Change: S541T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: S541T

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect not run
Transcript: ENSMUST00000162743
AA Change: S70T
Predicted Effect probably benign
Transcript: ENSMUST00000203353
AA Change: S562T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757
AA Change: S562T

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: S562T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: S562T

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,562,308 (GRCm39) M312L probably benign Het
Adam7 C A 14: 68,745,305 (GRCm39) D640Y possibly damaging Het
Alcam T C 16: 52,094,599 (GRCm39) Y384C probably damaging Het
Apob A G 12: 8,063,737 (GRCm39) E289G probably damaging Het
Arhgap15 A T 2: 43,953,869 (GRCm39) R198S probably benign Het
Bbs2 G T 8: 94,819,042 (GRCm39) S109* probably null Het
Bfsp1 T C 2: 143,668,891 (GRCm39) S569G probably benign Het
Chst9 A T 18: 15,586,296 (GRCm39) I89N probably benign Het
Cntln A C 4: 84,889,466 (GRCm39) E316D probably benign Het
Csde1 T G 3: 102,947,250 (GRCm39) D67E probably damaging Het
Csf2rb T G 15: 78,233,257 (GRCm39) S855A possibly damaging Het
Cyp4a10 T A 4: 115,389,812 (GRCm39) D472E probably damaging Het
Cyp4f18 C A 8: 72,762,940 (GRCm39) R49L probably benign Het
Daam1 G T 12: 71,991,048 (GRCm39) V221L unknown Het
Dbr1 T G 9: 99,465,944 (GRCm39) D507E probably benign Het
Dhrs7c A G 11: 67,706,627 (GRCm39) M188V probably benign Het
Dicer1 A T 12: 104,660,990 (GRCm39) L1688* probably null Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
E2f3 G A 13: 30,102,619 (GRCm39) T91I probably damaging Het
Etaa1 A T 11: 17,897,853 (GRCm39) V157E probably damaging Het
Foxp2 A T 6: 15,394,770 (GRCm39) T157S probably benign Het
Frem2 A G 3: 53,458,767 (GRCm39) V2034A probably benign Het
Fzd10 T C 5: 128,679,180 (GRCm39) V300A possibly damaging Het
Gbf1 A T 19: 46,256,893 (GRCm39) M778L probably benign Het
Gm17472 T A 6: 42,958,068 (GRCm39) N112K probably benign Het
Gria4 T C 9: 4,424,330 (GRCm39) K845R probably benign Het
Igkv4-68 G A 6: 69,281,926 (GRCm39) R82C probably damaging Het
Itgb1 A T 8: 129,446,491 (GRCm39) I383F probably damaging Het
Kcnk12 T A 17: 88,054,033 (GRCm39) K210* probably null Het
Limch1 C G 5: 67,150,516 (GRCm39) D163E probably damaging Het
Mbd4 A T 6: 115,826,363 (GRCm39) D188E probably damaging Het
Myh9 C T 15: 77,665,310 (GRCm39) probably null Het
Nbeal2 T C 9: 110,473,734 (GRCm39) E28G probably damaging Het
Nfatc4 A G 14: 56,064,116 (GRCm39) E201G probably damaging Het
Nrap G A 19: 56,323,583 (GRCm39) H1330Y probably damaging Het
Nudt14 A G 12: 112,898,648 (GRCm39) S151P probably damaging Het
Or14c45 C A 7: 86,176,324 (GRCm39) R120S probably damaging Het
Or2ag2 T A 7: 106,485,803 (GRCm39) T74S possibly damaging Het
Or7e165 T A 9: 19,694,514 (GRCm39) F28L possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Paqr9 A G 9: 95,442,163 (GRCm39) D51G probably damaging Het
Pcgf5 T A 19: 36,414,583 (GRCm39) F80I probably damaging Het
Pkhd1 T G 1: 20,617,565 (GRCm39) S1007R probably benign Het
Rab30 T C 7: 92,485,121 (GRCm39) Y196H probably benign Het
Setd2 A T 9: 110,380,298 (GRCm39) D1371V probably damaging Het
Slc48a1 A T 15: 97,688,581 (GRCm39) I140F possibly damaging Het
Sorl1 A G 9: 41,944,879 (GRCm39) V882A probably benign Het
Sptbn2 G T 19: 4,774,212 (GRCm39) G88W probably damaging Het
Tdrd12 A G 7: 35,189,455 (GRCm39) V427A possibly damaging Het
Tekt2 T C 4: 126,218,463 (GRCm39) D69G probably benign Het
Tie1 C T 4: 118,337,707 (GRCm39) V463I probably benign Het
Tmem150c G T 5: 100,227,813 (GRCm39) H217N probably damaging Het
Tnks2 G A 19: 36,866,252 (GRCm39) G1080R probably damaging Het
Ttll4 G A 1: 74,727,011 (GRCm39) probably null Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCAAATGTAGTAAAGGGTTAGC -3'
(R):5'- GACTCCAATACAGTATCAGAATGC -3'

Sequencing Primer
(F):5'- GCGTTCCAGGCAAGCACTTTAC -3'
(R):5'- ACAGTATCAGAATGCATTTGCTG -3'
Posted On 2016-07-06