Incidental Mutation 'R5241:Gsdmc3'
ID400856
Institutional Source Beutler Lab
Gene Symbol Gsdmc3
Ensembl Gene ENSMUSG00000055827
Gene Namegasdermin C3
Synonyms9930109F21Rik
MMRRC Submission 042812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5241 (G1)
Quality Score181
Status Not validated
Chromosome15
Chromosomal Location63857724-63878558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63864146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 202 (S202P)
Ref Sequence ENSEMBL: ENSMUSP00000139472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089894] [ENSMUST00000185526] [ENSMUST00000190682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089894
AA Change: S202P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087339
Gene: ENSMUSG00000055827
AA Change: S202P

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 2.1e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185526
AA Change: S202P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140272
Gene: ENSMUSG00000055827
AA Change: S202P

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190682
AA Change: S202P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139472
Gene: ENSMUSG00000055827
AA Change: S202P

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930033H14Rik A G 10: 69,212,751 probably null Het
Adgrb3 T C 1: 25,111,790 T881A possibly damaging Het
Adgrv1 A T 13: 81,488,929 C3464* probably null Het
Afp A G 5: 90,501,614 M347V probably benign Het
Apc2 A G 10: 80,312,234 T1041A probably benign Het
Atl1 T C 12: 69,959,113 S398P possibly damaging Het
Atp8b4 G A 2: 126,383,726 P528L probably benign Het
Bahcc1 C A 11: 120,271,403 P176T probably damaging Het
Bsnd A G 4: 106,487,985 V88A probably benign Het
Dnah7c T A 1: 46,530,500 F687Y probably benign Het
Dok6 T C 18: 89,598,789 I23M possibly damaging Het
Fcgbp A T 7: 28,085,199 D228V probably damaging Het
Gatad2a G A 8: 69,918,017 Q107* probably null Het
Glis3 G T 19: 28,350,023 T663K probably benign Het
Gm10784 T A 13: 49,945,093 noncoding transcript Het
Gsdmc2 C T 15: 63,824,894 R476H probably benign Het
Map3k8 T C 18: 4,340,750 E188G probably damaging Het
Mccc1 T A 3: 35,974,196 Q487L probably benign Het
Msantd1 A G 5: 34,921,469 D116G probably damaging Het
Myh1 T A 11: 67,204,449 S212T probably benign Het
Nr1h4 A G 10: 89,483,489 Y158H probably damaging Het
Olfr1180 T C 2: 88,412,098 T187A possibly damaging Het
Olfr421-ps1 T A 1: 174,152,101 I195N probably benign Het
Olfr585 T C 7: 103,098,317 V192A probably benign Het
Pcnt A T 10: 76,433,617 H272Q probably benign Het
Pdia5 T C 16: 35,429,775 N242S probably benign Het
Pkd1l2 A T 8: 117,035,118 D1441E probably damaging Het
Runx2 G T 17: 44,639,777 Y203* probably null Het
Sdr9c7 T G 10: 127,909,790 I257S probably benign Het
Slitrk1 A G 14: 108,913,012 M89T probably benign Het
St14 G T 9: 31,100,418 C397* probably null Het
Tas2r123 T C 6: 132,847,218 I26T probably benign Het
Tmem144 A T 3: 79,814,124 M329K probably benign Het
Tmem252 T C 19: 24,674,127 M20T probably benign Het
Umodl1 T C 17: 30,984,092 V473A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Xirp2 C T 2: 67,482,360 R58* probably null Het
Zer1 A C 2: 30,104,970 L471R probably damaging Het
Zfp101 C T 17: 33,382,236 C182Y probably benign Het
Other mutations in Gsdmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gsdmc3 APN 15 63859677 missense probably benign 0.05
IGL01125:Gsdmc3 APN 15 63861457 missense probably benign 0.09
R0490:Gsdmc3 UTSW 15 63860250 missense possibly damaging 0.88
R0620:Gsdmc3 UTSW 15 63859693 missense probably damaging 1.00
R0932:Gsdmc3 UTSW 15 63858551 critical splice acceptor site probably null
R1298:Gsdmc3 UTSW 15 63860281 missense probably damaging 0.99
R1378:Gsdmc3 UTSW 15 63859586 splice site probably benign
R1815:Gsdmc3 UTSW 15 63869116 missense probably damaging 1.00
R1962:Gsdmc3 UTSW 15 63858466 missense probably damaging 1.00
R1965:Gsdmc3 UTSW 15 63858447 missense probably damaging 1.00
R2088:Gsdmc3 UTSW 15 63860214 critical splice donor site probably null
R2090:Gsdmc3 UTSW 15 63866782 missense probably benign 0.07
R2126:Gsdmc3 UTSW 15 63858534 nonsense probably null
R2276:Gsdmc3 UTSW 15 63860256 missense probably benign 0.09
R4412:Gsdmc3 UTSW 15 63866796 missense probably benign 0.18
R4913:Gsdmc3 UTSW 15 63858273 makesense probably null
R6016:Gsdmc3 UTSW 15 63868412 missense probably benign 0.07
R6026:Gsdmc3 UTSW 15 63866751 missense probably damaging 1.00
R6291:Gsdmc3 UTSW 15 63860241 missense probably benign 0.00
R6698:Gsdmc3 UTSW 15 63860271 missense possibly damaging 0.94
R7316:Gsdmc3 UTSW 15 63858402 missense possibly damaging 0.81
R7566:Gsdmc3 UTSW 15 63861661 missense possibly damaging 0.77
R7717:Gsdmc3 UTSW 15 63869212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCTCTGCAACTACAGC -3'
(R):5'- GGAAGGGACTGCTAGTATTTTCTC -3'

Sequencing Primer
(F):5'- CTGCAACTACAGCTAGAAGTATATG -3'
(R):5'- GGAATGTTTTGTCTCCCC -3'
Posted On2016-07-06