Incidental Mutation 'R5202:Cntln'
ID 400859
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 042777-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R5202 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84889466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 316 (E316D)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: E316D

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: E316D

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: E316D

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: E316D

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,562,308 (GRCm39) M312L probably benign Het
Adam7 C A 14: 68,745,305 (GRCm39) D640Y possibly damaging Het
Alcam T C 16: 52,094,599 (GRCm39) Y384C probably damaging Het
Apob A G 12: 8,063,737 (GRCm39) E289G probably damaging Het
Arhgap15 A T 2: 43,953,869 (GRCm39) R198S probably benign Het
Bbs2 G T 8: 94,819,042 (GRCm39) S109* probably null Het
Bfsp1 T C 2: 143,668,891 (GRCm39) S569G probably benign Het
Chst9 A T 18: 15,586,296 (GRCm39) I89N probably benign Het
Csde1 T G 3: 102,947,250 (GRCm39) D67E probably damaging Het
Csf2rb T G 15: 78,233,257 (GRCm39) S855A possibly damaging Het
Cyp4a10 T A 4: 115,389,812 (GRCm39) D472E probably damaging Het
Cyp4f18 C A 8: 72,762,940 (GRCm39) R49L probably benign Het
Daam1 G T 12: 71,991,048 (GRCm39) V221L unknown Het
Dbr1 T G 9: 99,465,944 (GRCm39) D507E probably benign Het
Dhrs7c A G 11: 67,706,627 (GRCm39) M188V probably benign Het
Dicer1 A T 12: 104,660,990 (GRCm39) L1688* probably null Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
E2f3 G A 13: 30,102,619 (GRCm39) T91I probably damaging Het
Etaa1 A T 11: 17,897,853 (GRCm39) V157E probably damaging Het
Foxp2 A T 6: 15,394,770 (GRCm39) T157S probably benign Het
Frem2 A G 3: 53,458,767 (GRCm39) V2034A probably benign Het
Fzd10 T C 5: 128,679,180 (GRCm39) V300A possibly damaging Het
Gbf1 A T 19: 46,256,893 (GRCm39) M778L probably benign Het
Gm17472 T A 6: 42,958,068 (GRCm39) N112K probably benign Het
Gria4 T C 9: 4,424,330 (GRCm39) K845R probably benign Het
Hspa4l T A 3: 40,736,001 (GRCm39) S541T probably benign Het
Igkv4-68 G A 6: 69,281,926 (GRCm39) R82C probably damaging Het
Itgb1 A T 8: 129,446,491 (GRCm39) I383F probably damaging Het
Kcnk12 T A 17: 88,054,033 (GRCm39) K210* probably null Het
Limch1 C G 5: 67,150,516 (GRCm39) D163E probably damaging Het
Mbd4 A T 6: 115,826,363 (GRCm39) D188E probably damaging Het
Myh9 C T 15: 77,665,310 (GRCm39) probably null Het
Nbeal2 T C 9: 110,473,734 (GRCm39) E28G probably damaging Het
Nfatc4 A G 14: 56,064,116 (GRCm39) E201G probably damaging Het
Nrap G A 19: 56,323,583 (GRCm39) H1330Y probably damaging Het
Nudt14 A G 12: 112,898,648 (GRCm39) S151P probably damaging Het
Or14c45 C A 7: 86,176,324 (GRCm39) R120S probably damaging Het
Or2ag2 T A 7: 106,485,803 (GRCm39) T74S possibly damaging Het
Or7e165 T A 9: 19,694,514 (GRCm39) F28L possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Paqr9 A G 9: 95,442,163 (GRCm39) D51G probably damaging Het
Pcgf5 T A 19: 36,414,583 (GRCm39) F80I probably damaging Het
Pkhd1 T G 1: 20,617,565 (GRCm39) S1007R probably benign Het
Rab30 T C 7: 92,485,121 (GRCm39) Y196H probably benign Het
Setd2 A T 9: 110,380,298 (GRCm39) D1371V probably damaging Het
Slc48a1 A T 15: 97,688,581 (GRCm39) I140F possibly damaging Het
Sorl1 A G 9: 41,944,879 (GRCm39) V882A probably benign Het
Sptbn2 G T 19: 4,774,212 (GRCm39) G88W probably damaging Het
Tdrd12 A G 7: 35,189,455 (GRCm39) V427A possibly damaging Het
Tekt2 T C 4: 126,218,463 (GRCm39) D69G probably benign Het
Tie1 C T 4: 118,337,707 (GRCm39) V463I probably benign Het
Tmem150c G T 5: 100,227,813 (GRCm39) H217N probably damaging Het
Tnks2 G A 19: 36,866,252 (GRCm39) G1080R probably damaging Het
Ttll4 G A 1: 74,727,011 (GRCm39) probably null Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGATGAATCCTGTACATTCCCC -3'
(R):5'- TAGTGCCGCTTTAGTCACAC -3'

Sequencing Primer
(F):5'- AATCCTGTACATTCCCCCTGCATC -3'
(R):5'- ACTATTCCGGATTTTCACTGCATAAC -3'
Posted On 2016-07-06