Mutagenetix > Incidental Mutation

Incidental Mutation 'R5202:Cntln'

400859

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

042777-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R5202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 84971229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 316 (E316D)

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably benign
Transcript: ENSMUST00000047023
AA Change: E316D

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: E316D

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169371
AA Change: E316D

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: E316D

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,731,964	M312L	probably benign	Het
Adam7	C	A	14: 68,507,856	D640Y	possibly damaging	Het
Alcam	T	C	16: 52,274,236	Y384C	probably damaging	Het
Apob	A	G	12: 8,013,737	E289G	probably damaging	Het
Arhgap15	A	T	2: 44,063,857	R198S	probably benign	Het
Bbs2	G	T	8: 94,092,414	S109*	probably null	Het
Bfsp1	T	C	2: 143,826,971	S569G	probably benign	Het
Chst9	A	T	18: 15,453,239	I89N	probably benign	Het
Csde1	T	G	3: 103,039,934	D67E	probably damaging	Het
Csf2rb	T	G	15: 78,349,057	S855A	possibly damaging	Het
Cyp4a10	T	A	4: 115,532,615	D472E	probably damaging	Het
Cyp4f18	C	A	8: 72,009,096	R49L	probably benign	Het
Daam1	G	T	12: 71,944,274	V221L	unknown	Het
Dbr1	T	G	9: 99,583,891	D507E	probably benign	Het
Dhrs7c	A	G	11: 67,815,801	M188V	probably benign	Het
Dicer1	A	T	12: 104,694,731	L1688*	probably null	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
E2f3	G	A	13: 29,918,636	T91I	probably damaging	Het
Etaa1	A	T	11: 17,947,853	V157E	probably damaging	Het
Foxp2	A	T	6: 15,394,771	T157S	probably benign	Het
Frem2	A	G	3: 53,551,346	V2034A	probably benign	Het
Fzd10	T	C	5: 128,602,116	V300A	possibly damaging	Het
Gbf1	A	T	19: 46,268,454	M778L	probably benign	Het
Gm17472	T	A	6: 42,981,134	N112K	probably benign	Het
Gria4	T	C	9: 4,424,330	K845R	probably benign	Het
Hspa4l	T	A	3: 40,781,569	S541T	probably benign	Het
Igkv4-68	G	A	6: 69,304,942	R82C	probably damaging	Het
Itgb1	A	T	8: 128,720,010	I383F	probably damaging	Het
Kcnk12	T	A	17: 87,746,605	K210*	probably null	Het
Limch1	C	G	5: 66,993,173	D163E	probably damaging	Het
Mbd4	A	T	6: 115,849,402	D188E	probably damaging	Het
Myh9	C	T	15: 77,781,110		probably null	Het
Nbeal2	T	C	9: 110,644,666	E28G	probably damaging	Het
Nfatc4	A	G	14: 55,826,659	E201G	probably damaging	Het
Nrap	G	A	19: 56,335,151	H1330Y	probably damaging	Het
Nudt14	A	G	12: 112,935,028	S151P	probably damaging	Het
Olfr297	C	A	7: 86,527,116	R120S	probably damaging	Het
Olfr58	T	A	9: 19,783,218	F28L	possibly damaging	Het
Olfr706	T	A	7: 106,886,596	T74S	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Paqr9	A	G	9: 95,560,110	D51G	probably damaging	Het
Pcgf5	T	A	19: 36,437,183	F80I	probably damaging	Het
Pkhd1	T	G	1: 20,547,341	S1007R	probably benign	Het
Rab30	T	C	7: 92,835,913	Y196H	probably benign	Het
Setd2	A	T	9: 110,551,230	D1371V	probably damaging	Het
Slc48a1	A	T	15: 97,790,700	I140F	possibly damaging	Het
Sorl1	A	G	9: 42,033,583	V882A	probably benign	Het
Sptbn2	G	T	19: 4,724,184	G88W	probably damaging	Het
Tdrd12	A	G	7: 35,490,030	V427A	possibly damaging	Het
Tekt2	T	C	4: 126,324,670	D69G	probably benign	Het
Tie1	C	T	4: 118,480,510	V463I	probably benign	Het
Tmem150c	G	T	5: 100,079,954	H217N	probably damaging	Het
Tnks2	G	A	19: 36,888,852	G1080R	probably damaging	Het
Ttll4	G	A	1: 74,687,852		probably null	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGATGAATCCTGTACATTCCCC -3'
(R):5'- TAGTGCCGCTTTAGTCACAC -3'

Sequencing Primer
(F):5'- AATCCTGTACATTCCCCCTGCATC -3'
(R):5'- ACTATTCCGGATTTTCACTGCATAAC -3'

Posted On

2016-07-06