Mutagenetix > Incidental Mutations

Incidental Mutation 'R5202:Fzd10'

400872

Institutional Source

Beutler Lab

Gene Symbol

Fzd10

Ensembl Gene

ENSMUSG00000081683

Gene Name

frizzled class receptor 10

Synonyms

Fz-10

MMRRC Submission

042777-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128600844-128604093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128602116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 300 (V300A)

Ref Sequence

ENSEMBL: ENSMUSP00000114114 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117102]

AlphaFold

Q8BKG4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000091324

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117102
AA Change: V300A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: V300A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FRI	34	153	7.83e-68	SMART
Frizzled	218	542	2.62e-207	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154305

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199981

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,731,964	M312L	probably benign	Het
Adam7	C	A	14: 68,507,856	D640Y	possibly damaging	Het
Alcam	T	C	16: 52,274,236	Y384C	probably damaging	Het
Apob	A	G	12: 8,013,737	E289G	probably damaging	Het
Arhgap15	A	T	2: 44,063,857	R198S	probably benign	Het
Bbs2	G	T	8: 94,092,414	S109*	probably null	Het
Bfsp1	T	C	2: 143,826,971	S569G	probably benign	Het
Chst9	A	T	18: 15,453,239	I89N	probably benign	Het
Cntln	A	C	4: 84,971,229	E316D	probably benign	Het
Csde1	T	G	3: 103,039,934	D67E	probably damaging	Het
Csf2rb	T	G	15: 78,349,057	S855A	possibly damaging	Het
Cyp4a10	T	A	4: 115,532,615	D472E	probably damaging	Het
Cyp4f18	C	A	8: 72,009,096	R49L	probably benign	Het
Daam1	G	T	12: 71,944,274	V221L	unknown	Het
Dbr1	T	G	9: 99,583,891	D507E	probably benign	Het
Dhrs7c	A	G	11: 67,815,801	M188V	probably benign	Het
Dicer1	A	T	12: 104,694,731	L1688*	probably null	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
E2f3	G	A	13: 29,918,636	T91I	probably damaging	Het
Etaa1	A	T	11: 17,947,853	V157E	probably damaging	Het
Foxp2	A	T	6: 15,394,771	T157S	probably benign	Het
Frem2	A	G	3: 53,551,346	V2034A	probably benign	Het
Gbf1	A	T	19: 46,268,454	M778L	probably benign	Het
Gm17472	T	A	6: 42,981,134	N112K	probably benign	Het
Gria4	T	C	9: 4,424,330	K845R	probably benign	Het
Hspa4l	T	A	3: 40,781,569	S541T	probably benign	Het
Igkv4-68	G	A	6: 69,304,942	R82C	probably damaging	Het
Itgb1	A	T	8: 128,720,010	I383F	probably damaging	Het
Kcnk12	T	A	17: 87,746,605	K210*	probably null	Het
Limch1	C	G	5: 66,993,173	D163E	probably damaging	Het
Mbd4	A	T	6: 115,849,402	D188E	probably damaging	Het
Myh9	C	T	15: 77,781,110		probably null	Het
Nbeal2	T	C	9: 110,644,666	E28G	probably damaging	Het
Nfatc4	A	G	14: 55,826,659	E201G	probably damaging	Het
Nrap	G	A	19: 56,335,151	H1330Y	probably damaging	Het
Nudt14	A	G	12: 112,935,028	S151P	probably damaging	Het
Olfr297	C	A	7: 86,527,116	R120S	probably damaging	Het
Olfr58	T	A	9: 19,783,218	F28L	possibly damaging	Het
Olfr706	T	A	7: 106,886,596	T74S	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Paqr9	A	G	9: 95,560,110	D51G	probably damaging	Het
Pcgf5	T	A	19: 36,437,183	F80I	probably damaging	Het
Pkhd1	T	G	1: 20,547,341	S1007R	probably benign	Het
Rab30	T	C	7: 92,835,913	Y196H	probably benign	Het
Setd2	A	T	9: 110,551,230	D1371V	probably damaging	Het
Slc48a1	A	T	15: 97,790,700	I140F	possibly damaging	Het
Sorl1	A	G	9: 42,033,583	V882A	probably benign	Het
Sptbn2	G	T	19: 4,724,184	G88W	probably damaging	Het
Tdrd12	A	G	7: 35,490,030	V427A	possibly damaging	Het
Tekt2	T	C	4: 126,324,670	D69G	probably benign	Het
Tie1	C	T	4: 118,480,510	V463I	probably benign	Het
Tmem150c	G	T	5: 100,079,954	H217N	probably damaging	Het
Tnks2	G	A	19: 36,888,852	G1080R	probably damaging	Het
Ttll4	G	A	1: 74,687,852		probably null	Het

Other mutations in Fzd10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Fzd10	APN	5	128601528	missense	probably damaging	1.00
IGL02354:Fzd10	APN	5	128601868	missense	possibly damaging	0.89
IGL02361:Fzd10	APN	5	128601868	missense	possibly damaging	0.89
IGL03088:Fzd10	APN	5	128602605	missense	possibly damaging	0.81
R0530:Fzd10	UTSW	5	128602013	missense	probably damaging	1.00
R0645:Fzd10	UTSW	5	128602598	missense	possibly damaging	0.94
R1515:Fzd10	UTSW	5	128602559	missense	probably damaging	1.00
R3930:Fzd10	UTSW	5	128602412	missense	probably damaging	1.00
R4467:Fzd10	UTSW	5	128601276	missense	probably benign	0.01
R4976:Fzd10	UTSW	5	128602114	nonsense	probably null
R5156:Fzd10	UTSW	5	128601302	missense	possibly damaging	0.68
R5874:Fzd10	UTSW	5	128601300	missense	probably benign	0.41
R6238:Fzd10	UTSW	5	128602931	missense	probably damaging	0.99
R6921:Fzd10	UTSW	5	128601582	missense	probably damaging	0.99
R7684:Fzd10	UTSW	5	128601416	missense	possibly damaging	0.73
R8093:Fzd10	UTSW	5	128602239	missense	probably benign	0.14
R9011:Fzd10	UTSW	5	128602305	missense	probably damaging	1.00
R9013:Fzd10	UTSW	5	128602305	missense	probably damaging	1.00
R9014:Fzd10	UTSW	5	128602305	missense	probably damaging	1.00
R9332:Fzd10	UTSW	5	128601252	missense	possibly damaging	0.92
Z1088:Fzd10	UTSW	5	128601246	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATGTGTATTGGAGCCGCGAC -3'
(R):5'- TGCCAGGTGAAAGTAGCTG -3'

Sequencing Primer
(F):5'- CCATCTGGTCCGTGCTGTG -3'
(R):5'- AAAGTAGCTGCTGTTGGCTTCAATG -3'

Posted On

2016-07-06