Incidental Mutation 'R5202:Fzd10'
ID 400872
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
MMRRC Submission 042777-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5202 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128602116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 300 (V300A)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091324
Predicted Effect possibly damaging
Transcript: ENSMUST00000117102
AA Change: V300A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: V300A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199981
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,731,964 M312L probably benign Het
Adam7 C A 14: 68,507,856 D640Y possibly damaging Het
Alcam T C 16: 52,274,236 Y384C probably damaging Het
Apob A G 12: 8,013,737 E289G probably damaging Het
Arhgap15 A T 2: 44,063,857 R198S probably benign Het
Bbs2 G T 8: 94,092,414 S109* probably null Het
Bfsp1 T C 2: 143,826,971 S569G probably benign Het
Chst9 A T 18: 15,453,239 I89N probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Csde1 T G 3: 103,039,934 D67E probably damaging Het
Csf2rb T G 15: 78,349,057 S855A possibly damaging Het
Cyp4a10 T A 4: 115,532,615 D472E probably damaging Het
Cyp4f18 C A 8: 72,009,096 R49L probably benign Het
Daam1 G T 12: 71,944,274 V221L unknown Het
Dbr1 T G 9: 99,583,891 D507E probably benign Het
Dhrs7c A G 11: 67,815,801 M188V probably benign Het
Dicer1 A T 12: 104,694,731 L1688* probably null Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
E2f3 G A 13: 29,918,636 T91I probably damaging Het
Etaa1 A T 11: 17,947,853 V157E probably damaging Het
Foxp2 A T 6: 15,394,771 T157S probably benign Het
Frem2 A G 3: 53,551,346 V2034A probably benign Het
Gbf1 A T 19: 46,268,454 M778L probably benign Het
Gm17472 T A 6: 42,981,134 N112K probably benign Het
Gria4 T C 9: 4,424,330 K845R probably benign Het
Hspa4l T A 3: 40,781,569 S541T probably benign Het
Igkv4-68 G A 6: 69,304,942 R82C probably damaging Het
Itgb1 A T 8: 128,720,010 I383F probably damaging Het
Kcnk12 T A 17: 87,746,605 K210* probably null Het
Limch1 C G 5: 66,993,173 D163E probably damaging Het
Mbd4 A T 6: 115,849,402 D188E probably damaging Het
Myh9 C T 15: 77,781,110 probably null Het
Nbeal2 T C 9: 110,644,666 E28G probably damaging Het
Nfatc4 A G 14: 55,826,659 E201G probably damaging Het
Nrap G A 19: 56,335,151 H1330Y probably damaging Het
Nudt14 A G 12: 112,935,028 S151P probably damaging Het
Olfr297 C A 7: 86,527,116 R120S probably damaging Het
Olfr58 T A 9: 19,783,218 F28L possibly damaging Het
Olfr706 T A 7: 106,886,596 T74S possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr9 A G 9: 95,560,110 D51G probably damaging Het
Pcgf5 T A 19: 36,437,183 F80I probably damaging Het
Pkhd1 T G 1: 20,547,341 S1007R probably benign Het
Rab30 T C 7: 92,835,913 Y196H probably benign Het
Setd2 A T 9: 110,551,230 D1371V probably damaging Het
Slc48a1 A T 15: 97,790,700 I140F possibly damaging Het
Sorl1 A G 9: 42,033,583 V882A probably benign Het
Sptbn2 G T 19: 4,724,184 G88W probably damaging Het
Tdrd12 A G 7: 35,490,030 V427A possibly damaging Het
Tekt2 T C 4: 126,324,670 D69G probably benign Het
Tie1 C T 4: 118,480,510 V463I probably benign Het
Tmem150c G T 5: 100,079,954 H217N probably damaging Het
Tnks2 G A 19: 36,888,852 G1080R probably damaging Het
Ttll4 G A 1: 74,687,852 probably null Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0530:Fzd10 UTSW 5 128602013 missense probably damaging 1.00
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6238:Fzd10 UTSW 5 128602931 missense probably damaging 0.99
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R7684:Fzd10 UTSW 5 128601416 missense possibly damaging 0.73
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9013:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9014:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTGTATTGGAGCCGCGAC -3'
(R):5'- TGCCAGGTGAAAGTAGCTG -3'

Sequencing Primer
(F):5'- CCATCTGGTCCGTGCTGTG -3'
(R):5'- AAAGTAGCTGCTGTTGGCTTCAATG -3'
Posted On 2016-07-06