Incidental Mutation 'R5242:Smarcal1'
ID400885
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene NameSWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms6030401P21Rik, Mharp
MMRRC Submission 042813-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5242 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location72583251-72633134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72591083 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000114848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000133123] [ENSMUST00000152225]
Predicted Effect probably benign
Transcript: ENSMUST00000047615
AA Change: S261P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: S261P

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133123
AA Change: S99P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114848
Gene: ENSMUSG00000039354
AA Change: S99P

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 66 106 1.7e-14 PFAM
Pfam:HARP 140 194 2.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect probably benign
Transcript: ENSMUST00000152225
AA Change: S261P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: S261P

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156797
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A G 8: 36,511,930 K229R probably benign Het
Adgrl1 T C 8: 83,931,082 V439A possibly damaging Het
Aldh6a1 A G 12: 84,436,383 V390A probably damaging Het
Alox5 T C 6: 116,460,966 D20G probably damaging Het
Atp2a2 A T 5: 122,461,946 F487I probably damaging Het
BC048679 G A 7: 81,495,343 T84M probably damaging Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdh6 A G 15: 13,064,411 V131A probably benign Het
Chrna9 A G 5: 65,977,080 T425A probably benign Het
Ddx39 A G 8: 83,721,811 S231G probably benign Het
Diaph1 C T 18: 37,851,635 G1176R probably damaging Het
Dnah10 G T 5: 124,787,420 V2230L probably benign Het
Foxo1 T C 3: 52,269,255 S152P probably damaging Het
Fras1 T A 5: 96,657,250 D1250E probably benign Het
G6pd2 A G 5: 61,809,442 I187V probably benign Het
Gm10113 T C 13: 46,177,516 noncoding transcript Het
Gm13088 A T 4: 143,655,611 L172I probably benign Het
Hoxd1 A G 2: 74,763,448 D116G probably damaging Het
Igkv13-85 A T 6: 68,930,560 I19K probably benign Het
Jag2 C T 12: 112,916,866 V288M probably damaging Het
Ndrg2 A G 14: 51,911,084 probably null Het
Neurl3 G A 1: 36,269,420 Q104* probably null Het
Nudt16l1 C T 16: 4,939,621 R133W probably damaging Het
Oasl2 A T 5: 114,905,061 Q298L possibly damaging Het
Olfr139 A T 11: 74,045,022 M84K possibly damaging Het
Olfr559 C T 7: 102,724,276 M71I probably benign Het
Pnma2 C A 14: 66,916,297 Q57K probably benign Het
Rps7 T A 12: 28,631,137 E188D probably benign Het
Rrp1b T C 17: 32,051,703 V212A possibly damaging Het
Rsg1 T C 4: 141,219,847 Y180H probably damaging Het
Serpina9 C A 12: 104,008,385 A170S probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Siae C T 9: 37,644,852 P435S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tas2r124 T C 6: 132,755,540 Y271H possibly damaging Het
Thsd7a A T 6: 12,327,583 I1430K probably damaging Het
Tmem110 T A 14: 30,825,836 F36I probably damaging Het
Tsc22d2 T A 3: 58,415,939 V84E possibly damaging Het
Ube2s C T 7: 4,810,435 R110Q possibly damaging Het
Usp3 C T 9: 66,527,150 C283Y probably damaging Het
Vmn2r81 T A 10: 79,293,475 Y733* probably null Het
Wdr75 T A 1: 45,817,327 C503* probably null Het
Zfp764 T C 7: 127,405,369 M197V probably benign Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72616565 missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72586131 missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72616520 nonsense probably null
IGL02007:Smarcal1 APN 1 72595940 missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72633055 utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72620088 missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72598935 splice site probably null
IGL03135:Smarcal1 APN 1 72616501 splice site probably null
IGL03306:Smarcal1 APN 1 72626466 missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72632851 missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72595811 nonsense probably null
R0396:Smarcal1 UTSW 1 72626473 missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72598856 missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72585961 missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72586099 missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R4164:Smarcal1 UTSW 1 72626689 intron probably benign
R4438:Smarcal1 UTSW 1 72611478 intron probably benign
R4722:Smarcal1 UTSW 1 72611337 missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72597440 missense probably benign
R4989:Smarcal1 UTSW 1 72632860 missense possibly damaging 0.84
R5367:Smarcal1 UTSW 1 72595976 critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72598909 missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72626617 missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72591253 missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72586213 missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72591137 missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72616557 missense possibly damaging 0.82
R6447:Smarcal1 UTSW 1 72585874 missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72591173 missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72612942 missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72586020 missense probably benign 0.08
R7975:Smarcal1 UTSW 1 72612991 missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72626563 missense probably damaging 1.00
R8407:Smarcal1 UTSW 1 72601395 missense probably benign 0.04
R8901:Smarcal1 UTSW 1 72585780 missense possibly damaging 0.71
Z1177:Smarcal1 UTSW 1 72591267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTCAGTTAAAGGATGCTCG -3'
(R):5'- TCATAGATCGCACAGAGATTGG -3'

Sequencing Primer
(F):5'- CCTCAGTTAAAGGATGCTCGTAAGC -3'
(R):5'- ACAGAGATTGGTCACTTGCC -3'
Posted On2016-07-06