Incidental Mutation 'R0408:Klra1'
ID40089
Institutional Source Beutler Lab
Gene Symbol Klra1
Ensembl Gene ENSMUSG00000079853
Gene Namekiller cell lectin-like receptor, subfamily A, member 1
SynonymsLy49o<129>, Ly49A
MMRRC Submission 038610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R0408 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location130363917-130386874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130377774 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 94 (I94F)
Ref Sequence ENSEMBL: ENSMUSP00000032288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032288]
Predicted Effect probably benign
Transcript: ENSMUST00000032288
AA Change: I94F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032288
Gene: ENSMUSG00000079853
AA Change: I94F

DomainStartEndE-ValueType
Blast:CLECT 73 118 9e-8 BLAST
CLECT 139 254 4.02e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127570
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,853,446 N1032K probably damaging Het
Abcc8 A G 7: 46,107,033 I1416T probably damaging Het
Aco2 T C 15: 81,913,118 probably null Het
Akap13 C T 7: 75,746,796 L2514F probably damaging Het
Aldh1a3 A G 7: 66,406,050 V331A probably damaging Het
Arid3a T A 10: 79,950,833 D473E probably benign Het
Atg9a A G 1: 75,185,295 S536P probably damaging Het
Atxn7 A T 14: 14,100,317 S668C probably damaging Het
Bcar3 A T 3: 122,508,384 I243F probably damaging Het
Bend6 G A 1: 33,862,753 P183S probably damaging Het
Bfsp2 A T 9: 103,480,100 S43T probably benign Het
Camk4 G A 18: 33,129,792 D136N probably damaging Het
Ceacam3 G T 7: 17,151,883 probably benign Het
Chrm3 T C 13: 9,877,933 I356V probably benign Het
Clec9a T A 6: 129,419,569 I133N possibly damaging Het
Ctnnd2 T C 15: 30,634,677 L157P probably damaging Het
Ddhd2 T C 8: 25,739,587 probably null Het
Def8 T C 8: 123,459,917 V436A probably damaging Het
Dock10 T C 1: 80,540,476 K1293R probably benign Het
Dync1h1 T G 12: 110,631,692 D1772E probably benign Het
Ephx4 G T 5: 107,413,521 G72C probably damaging Het
Fam136a T G 6: 86,366,725 V68G possibly damaging Het
Fam69c T A 18: 84,720,363 probably null Het
Fcgrt T C 7: 45,101,939 E195G probably damaging Het
Fut9 T A 4: 25,620,319 Q165L possibly damaging Het
Glb1l T C 1: 75,208,835 Y77C probably damaging Het
Gm16286 T C 18: 80,211,814 S108P probably damaging Het
Gpr26 T C 7: 131,967,520 V198A possibly damaging Het
Gpr26 C A 7: 131,974,272 probably null Het
Gsdma3 A C 11: 98,635,338 E296A probably benign Het
Hyou1 G T 9: 44,384,692 G385W probably damaging Het
Il17rb T C 14: 29,996,680 S482G probably benign Het
Itgb4 A T 11: 116,007,602 R1715W probably damaging Het
Jak2 A G 19: 29,286,317 S411G probably benign Het
Kdm3a C T 6: 71,611,679 D449N probably benign Het
Kif1bp T C 10: 62,566,053 I23M probably benign Het
Klhl26 T C 8: 70,452,480 D226G probably damaging Het
Lama3 A G 18: 12,456,837 D808G probably benign Het
Lrp1b C T 2: 40,677,591 M272I probably damaging Het
Masp2 A G 4: 148,606,039 D251G probably benign Het
Mob3b T C 4: 35,083,991 D66G probably damaging Het
Myo7a T C 7: 98,056,781 Q1863R probably damaging Het
Olfr119 G A 17: 37,701,299 V210I probably benign Het
Olfr1195 A T 2: 88,683,655 F26I probably benign Het
Pdgfd T A 9: 6,293,928 Y167* probably null Het
Pfas A G 11: 69,001,105 probably null Het
Plin1 T A 7: 79,722,646 T393S probably damaging Het
Prdm15 A T 16: 97,835,786 N110K possibly damaging Het
Prune2 T A 19: 17,122,310 V1726D probably benign Het
Sestd1 T A 2: 77,191,793 D518V probably damaging Het
Setd2 C T 9: 110,594,242 P344S probably damaging Het
Slc22a1 A T 17: 12,656,941 I462N probably damaging Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d14 G T 5: 36,571,299 T241K possibly damaging Het
Uaca T C 9: 60,871,859 L1176P possibly damaging Het
Ube2g1 G C 11: 72,672,965 G52A probably damaging Het
Utrn A G 10: 12,384,190 *957R probably null Het
Vmn2r125 A T 4: 156,350,858 E177V probably damaging Het
Vmn2r86 A G 10: 130,446,854 F631S probably damaging Het
Zc3h13 T A 14: 75,292,186 C42* probably null Het
Zc3h14 T G 12: 98,763,823 V13G probably damaging Het
Zfat A T 15: 68,180,292 V551D probably benign Het
Zfp618 C T 4: 63,086,572 R70W probably damaging Het
Other mutations in Klra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Klra1 APN 6 130364274 nonsense probably null
IGL01320:Klra1 APN 6 130364261 missense probably benign 0.02
IGL01322:Klra1 APN 6 130364261 missense probably benign 0.02
IGL02149:Klra1 APN 6 130375330 missense probably damaging 1.00
IGL02666:Klra1 APN 6 130364315 missense probably damaging 1.00
IGL02895:Klra1 APN 6 130375240 missense possibly damaging 0.51
R0004:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R0442:Klra1 UTSW 6 130372872 missense probably damaging 1.00
R0498:Klra1 UTSW 6 130372819 critical splice donor site probably null
R0765:Klra1 UTSW 6 130379092 splice site probably benign
R1761:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R1922:Klra1 UTSW 6 130372865 missense probably benign 0.01
R1987:Klra1 UTSW 6 130377779 missense probably benign
R2882:Klra1 UTSW 6 130377863 splice site probably null
R5054:Klra1 UTSW 6 130375284 missense probably damaging 0.99
R5190:Klra1 UTSW 6 130375278 missense probably damaging 1.00
R5572:Klra1 UTSW 6 130372839 missense possibly damaging 0.73
R5825:Klra1 UTSW 6 130380629 missense probably damaging 1.00
R6784:Klra1 UTSW 6 130372854 missense probably benign 0.00
Z1176:Klra1 UTSW 6 130372851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCTGGTTGATCTTCAAATTTTCCA -3'
(R):5'- ACAGAGGAAATCACTTTCAGGCTTTGC -3'

Sequencing Primer
(F):5'- TGCAACATACCTGTGTGCTG -3'
(R):5'- TGCTAAAATATAGCTTTGTAGGTGG -3'
Posted On2013-05-23