Incidental Mutation 'R5202:Olfr297'
ID400891
Institutional Source Beutler Lab
Gene Symbol Olfr297
Ensembl Gene ENSMUSG00000057067
Gene Nameolfactory receptor 297
SynonymsGA_x6K02T2NHDJ-9587747-9586815, MOR220-3
MMRRC Submission 042777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5202 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86519968-86528497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86527116 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 120 (R120S)
Ref Sequence ENSEMBL: ENSMUSP00000134371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071112] [ENSMUST00000172965]
Predicted Effect probably damaging
Transcript: ENSMUST00000071112
AA Change: R120S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132942
Gene: ENSMUSG00000057067
AA Change: R120S

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.9e-45 PFAM
Pfam:7tm_1 39 288 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172965
AA Change: R120S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: R120S

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,731,964 M312L probably benign Het
Adam7 C A 14: 68,507,856 D640Y possibly damaging Het
Alcam T C 16: 52,274,236 Y384C probably damaging Het
Apob A G 12: 8,013,737 E289G probably damaging Het
Arhgap15 A T 2: 44,063,857 R198S probably benign Het
Bbs2 G T 8: 94,092,414 S109* probably null Het
Bfsp1 T C 2: 143,826,971 S569G probably benign Het
Chst9 A T 18: 15,453,239 I89N probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Csde1 T G 3: 103,039,934 D67E probably damaging Het
Csf2rb T G 15: 78,349,057 S855A possibly damaging Het
Cyp4a10 T A 4: 115,532,615 D472E probably damaging Het
Cyp4f18 C A 8: 72,009,096 R49L probably benign Het
Daam1 G T 12: 71,944,274 V221L unknown Het
Dbr1 T G 9: 99,583,891 D507E probably benign Het
Dhrs7c A G 11: 67,815,801 M188V probably benign Het
Dicer1 A T 12: 104,694,731 L1688* probably null Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
E2f3 G A 13: 29,918,636 T91I probably damaging Het
Etaa1 A T 11: 17,947,853 V157E probably damaging Het
Foxp2 A T 6: 15,394,771 T157S probably benign Het
Frem2 A G 3: 53,551,346 V2034A probably benign Het
Fzd10 T C 5: 128,602,116 V300A possibly damaging Het
Gbf1 A T 19: 46,268,454 M778L probably benign Het
Gm17472 T A 6: 42,981,134 N112K probably benign Het
Gria4 T C 9: 4,424,330 K845R probably benign Het
Hspa4l T A 3: 40,781,569 S541T probably benign Het
Igkv4-68 G A 6: 69,304,942 R82C probably damaging Het
Itgb1 A T 8: 128,720,010 I383F probably damaging Het
Kcnk12 T A 17: 87,746,605 K210* probably null Het
Limch1 C G 5: 66,993,173 D163E probably damaging Het
Mbd4 A T 6: 115,849,402 D188E probably damaging Het
Myh9 C T 15: 77,781,110 probably null Het
Nbeal2 T C 9: 110,644,666 E28G probably damaging Het
Nfatc4 A G 14: 55,826,659 E201G probably damaging Het
Nrap G A 19: 56,335,151 H1330Y probably damaging Het
Nudt14 A G 12: 112,935,028 S151P probably damaging Het
Olfr58 T A 9: 19,783,218 F28L possibly damaging Het
Olfr706 T A 7: 106,886,596 T74S possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr9 A G 9: 95,560,110 D51G probably damaging Het
Pcgf5 T A 19: 36,437,183 F80I probably damaging Het
Pkhd1 T G 1: 20,547,341 S1007R probably benign Het
Rab30 T C 7: 92,835,913 Y196H probably benign Het
Setd2 A T 9: 110,551,230 D1371V probably damaging Het
Slc48a1 A T 15: 97,790,700 I140F possibly damaging Het
Sorl1 A G 9: 42,033,583 V882A probably benign Het
Sptbn2 G T 19: 4,724,184 G88W probably damaging Het
Tdrd12 A G 7: 35,490,030 V427A possibly damaging Het
Tekt2 T C 4: 126,324,670 D69G probably benign Het
Tie1 C T 4: 118,480,510 V463I probably benign Het
Tmem150c G T 5: 100,079,954 H217N probably damaging Het
Tnks2 G A 19: 36,888,852 G1080R probably damaging Het
Ttll4 G A 1: 74,687,852 probably null Het
Other mutations in Olfr297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr297 APN 7 86526778 missense probably benign 0.10
IGL01823:Olfr297 APN 7 86527041 missense probably damaging 1.00
PIT4378001:Olfr297 UTSW 7 86527098 missense possibly damaging 0.50
R0304:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R0737:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R2177:Olfr297 UTSW 7 86527662 missense probably benign 0.01
R2436:Olfr297 UTSW 7 86527383 missense probably damaging 0.99
R4289:Olfr297 UTSW 7 86527054 missense probably damaging 1.00
R4639:Olfr297 UTSW 7 86526761 start codon destroyed probably null 1.00
R5782:Olfr297 UTSW 7 86527213 missense probably damaging 0.98
R6446:Olfr297 UTSW 7 86527102 missense possibly damaging 0.90
R6615:Olfr297 UTSW 7 86526912 missense probably benign 0.06
R6920:Olfr297 UTSW 7 86527314 missense probably benign 0.00
R7150:Olfr297 UTSW 7 86527114 missense probably damaging 1.00
R7309:Olfr297 UTSW 7 86527141 missense probably damaging 1.00
R7621:Olfr297 UTSW 7 86527072 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTTGACCAGACCCTGAACAC -3'
(R):5'- TAAGCCTCAGCAAAGCAGGC -3'

Sequencing Primer
(F):5'- ATGTACTTCTTCCTCAGGAATCTG -3'
(R):5'- GCAGGCAGCTCACAGAAGAAC -3'
Posted On2016-07-06