Incidental Mutation 'R5242:Oasl2'
ID400902
Institutional Source Beutler Lab
Gene Symbol Oasl2
Ensembl Gene ENSMUSG00000029561
Gene Name2'-5' oligoadenylate synthetase-like 2
SynonymsMmu-OASL, M1204
MMRRC Submission 042813-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5242 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114896936-114912234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114905061 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 298 (Q298L)
Ref Sequence ENSEMBL: ENSMUSP00000031542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031542] [ENSMUST00000124716]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031542
AA Change: Q298L

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031542
Gene: ENSMUSG00000029561
AA Change: Q298L

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Pfam:OAS1_C 169 351 8.4e-77 PFAM
SCOP:d1euvb_ 355 427 4e-4 SMART
Blast:UBQ 355 430 9e-30 BLAST
UBQ 435 506 8.88e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124716
AA Change: Q78L

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115070
Gene: ENSMUSG00000029561
AA Change: Q78L

DomainStartEndE-ValueType
Pfam:OAS1_C 1 131 1.2e-48 PFAM
SCOP:d1euvb_ 135 207 6e-5 SMART
Blast:UBQ 135 210 9e-32 BLAST
Blast:UBQ 215 240 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137828
Predicted Effect probably benign
Transcript: ENSMUST00000144064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201445
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A G 8: 36,511,930 K229R probably benign Het
Adgrl1 T C 8: 83,931,082 V439A possibly damaging Het
Aldh6a1 A G 12: 84,436,383 V390A probably damaging Het
Alox5 T C 6: 116,460,966 D20G probably damaging Het
Atp2a2 A T 5: 122,461,946 F487I probably damaging Het
BC048679 G A 7: 81,495,343 T84M probably damaging Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdh6 A G 15: 13,064,411 V131A probably benign Het
Chrna9 A G 5: 65,977,080 T425A probably benign Het
Ddx39 A G 8: 83,721,811 S231G probably benign Het
Diaph1 C T 18: 37,851,635 G1176R probably damaging Het
Dnah10 G T 5: 124,787,420 V2230L probably benign Het
Foxo1 T C 3: 52,269,255 S152P probably damaging Het
Fras1 T A 5: 96,657,250 D1250E probably benign Het
G6pd2 A G 5: 61,809,442 I187V probably benign Het
Gm10113 T C 13: 46,177,516 noncoding transcript Het
Gm13088 A T 4: 143,655,611 L172I probably benign Het
Hoxd1 A G 2: 74,763,448 D116G probably damaging Het
Igkv13-85 A T 6: 68,930,560 I19K probably benign Het
Jag2 C T 12: 112,916,866 V288M probably damaging Het
Ndrg2 A G 14: 51,911,084 probably null Het
Neurl3 G A 1: 36,269,420 Q104* probably null Het
Nudt16l1 C T 16: 4,939,621 R133W probably damaging Het
Olfr139 A T 11: 74,045,022 M84K possibly damaging Het
Olfr559 C T 7: 102,724,276 M71I probably benign Het
Pnma2 C A 14: 66,916,297 Q57K probably benign Het
Rps7 T A 12: 28,631,137 E188D probably benign Het
Rrp1b T C 17: 32,051,703 V212A possibly damaging Het
Rsg1 T C 4: 141,219,847 Y180H probably damaging Het
Serpina9 C A 12: 104,008,385 A170S probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Siae C T 9: 37,644,852 P435S probably damaging Het
Smarcal1 T C 1: 72,591,083 S99P probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tas2r124 T C 6: 132,755,540 Y271H possibly damaging Het
Thsd7a A T 6: 12,327,583 I1430K probably damaging Het
Tmem110 T A 14: 30,825,836 F36I probably damaging Het
Tsc22d2 T A 3: 58,415,939 V84E possibly damaging Het
Ube2s C T 7: 4,810,435 R110Q possibly damaging Het
Usp3 C T 9: 66,527,150 C283Y probably damaging Het
Vmn2r81 T A 10: 79,293,475 Y733* probably null Het
Wdr75 T A 1: 45,817,327 C503* probably null Het
Zfp764 T C 7: 127,405,369 M197V probably benign Het
Other mutations in Oasl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Oasl2 APN 5 114897806 missense probably damaging 1.00
IGL02649:Oasl2 APN 5 114897692 missense probably damaging 1.00
IGL02810:Oasl2 APN 5 114897791 missense probably damaging 1.00
IGL03153:Oasl2 APN 5 114901332 missense probably benign 0.02
R0179:Oasl2 UTSW 5 114910912 missense probably benign
R1318:Oasl2 UTSW 5 114901381 missense probably benign 0.01
R1831:Oasl2 UTSW 5 114901306 missense probably benign 0.00
R1941:Oasl2 UTSW 5 114911362 utr 3 prime probably benign
R2068:Oasl2 UTSW 5 114911237 missense probably benign 0.01
R2104:Oasl2 UTSW 5 114911002 nonsense probably null
R2170:Oasl2 UTSW 5 114906800 missense probably damaging 0.99
R2437:Oasl2 UTSW 5 114911296 missense probably benign
R2882:Oasl2 UTSW 5 114911023 missense probably damaging 1.00
R3960:Oasl2 UTSW 5 114905037 missense probably benign 0.03
R3962:Oasl2 UTSW 5 114897747 missense probably benign 0.01
R4609:Oasl2 UTSW 5 114899796 missense possibly damaging 0.47
R4761:Oasl2 UTSW 5 114899775 missense probably benign 0.00
R5691:Oasl2 UTSW 5 114899767 missense possibly damaging 0.93
R6594:Oasl2 UTSW 5 114906775 missense probably benign 0.30
R7053:Oasl2 UTSW 5 114911230 missense possibly damaging 0.82
R7062:Oasl2 UTSW 5 114911091 nonsense probably null
R7688:Oasl2 UTSW 5 114897848 missense probably benign 0.01
R7753:Oasl2 UTSW 5 114905057 missense probably benign
R8026:Oasl2 UTSW 5 114902268 unclassified probably benign
R8160:Oasl2 UTSW 5 114901286 unclassified probably benign
R8479:Oasl2 UTSW 5 114897791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACCATCTACGCCTGGG -3'
(R):5'- GGTTGAACCACTCACAGACAGA -3'

Sequencing Primer
(F):5'- ACCATCTACGCCTGGGAGATG -3'
(R):5'- CAAAGAACTCCATGCTGGGTTTCG -3'
Posted On2016-07-06