Mutagenetix > Incidental Mutation

Incidental Mutation 'R5202:Gria4'

400903

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

042777-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R5202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4424330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 845 (K845R)

Ref Sequence

ENSEMBL: ENSMUSP00000148533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020
AA Change: K845R

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: K845R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508
AA Change: K845R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: K845R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212533
AA Change: K845R

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,731,964	M312L	probably benign	Het
Adam7	C	A	14: 68,507,856	D640Y	possibly damaging	Het
Alcam	T	C	16: 52,274,236	Y384C	probably damaging	Het
Apob	A	G	12: 8,013,737	E289G	probably damaging	Het
Arhgap15	A	T	2: 44,063,857	R198S	probably benign	Het
Bbs2	G	T	8: 94,092,414	S109*	probably null	Het
Bfsp1	T	C	2: 143,826,971	S569G	probably benign	Het
Chst9	A	T	18: 15,453,239	I89N	probably benign	Het
Cntln	A	C	4: 84,971,229	E316D	probably benign	Het
Csde1	T	G	3: 103,039,934	D67E	probably damaging	Het
Csf2rb	T	G	15: 78,349,057	S855A	possibly damaging	Het
Cyp4a10	T	A	4: 115,532,615	D472E	probably damaging	Het
Cyp4f18	C	A	8: 72,009,096	R49L	probably benign	Het
Daam1	G	T	12: 71,944,274	V221L	unknown	Het
Dbr1	T	G	9: 99,583,891	D507E	probably benign	Het
Dhrs7c	A	G	11: 67,815,801	M188V	probably benign	Het
Dicer1	A	T	12: 104,694,731	L1688*	probably null	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
E2f3	G	A	13: 29,918,636	T91I	probably damaging	Het
Etaa1	A	T	11: 17,947,853	V157E	probably damaging	Het
Foxp2	A	T	6: 15,394,771	T157S	probably benign	Het
Frem2	A	G	3: 53,551,346	V2034A	probably benign	Het
Fzd10	T	C	5: 128,602,116	V300A	possibly damaging	Het
Gbf1	A	T	19: 46,268,454	M778L	probably benign	Het
Gm17472	T	A	6: 42,981,134	N112K	probably benign	Het
Hspa4l	T	A	3: 40,781,569	S541T	probably benign	Het
Igkv4-68	G	A	6: 69,304,942	R82C	probably damaging	Het
Itgb1	A	T	8: 128,720,010	I383F	probably damaging	Het
Kcnk12	T	A	17: 87,746,605	K210*	probably null	Het
Limch1	C	G	5: 66,993,173	D163E	probably damaging	Het
Mbd4	A	T	6: 115,849,402	D188E	probably damaging	Het
Myh9	C	T	15: 77,781,110		probably null	Het
Nbeal2	T	C	9: 110,644,666	E28G	probably damaging	Het
Nfatc4	A	G	14: 55,826,659	E201G	probably damaging	Het
Nrap	G	A	19: 56,335,151	H1330Y	probably damaging	Het
Nudt14	A	G	12: 112,935,028	S151P	probably damaging	Het
Olfr297	C	A	7: 86,527,116	R120S	probably damaging	Het
Olfr58	T	A	9: 19,783,218	F28L	possibly damaging	Het
Olfr706	T	A	7: 106,886,596	T74S	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Paqr9	A	G	9: 95,560,110	D51G	probably damaging	Het
Pcgf5	T	A	19: 36,437,183	F80I	probably damaging	Het
Pkhd1	T	G	1: 20,547,341	S1007R	probably benign	Het
Rab30	T	C	7: 92,835,913	Y196H	probably benign	Het
Setd2	A	T	9: 110,551,230	D1371V	probably damaging	Het
Slc48a1	A	T	15: 97,790,700	I140F	possibly damaging	Het
Sorl1	A	G	9: 42,033,583	V882A	probably benign	Het
Sptbn2	G	T	19: 4,724,184	G88W	probably damaging	Het
Tdrd12	A	G	7: 35,490,030	V427A	possibly damaging	Het
Tekt2	T	C	4: 126,324,670	D69G	probably benign	Het
Tie1	C	T	4: 118,480,510	V463I	probably benign	Het
Tmem150c	G	T	5: 100,079,954	H217N	probably damaging	Het
Tnks2	G	A	19: 36,888,852	G1080R	probably damaging	Het
Ttll4	G	A	1: 74,687,852		probably null	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACCGTGTTCACAGGATGCATC -3'
(R):5'- CCTGCATCAGCGACTTATACC -3'

Sequencing Primer
(F):5'- GATGCATCCCCCGCTCAC -3'
(R):5'- GGCTATTTGGATATTATGCATCCC -3'

Posted On

2016-07-06