Incidental Mutation 'R5202:Gria4'
ID 400903
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Glur-4, spkw1, Gluralpha4, Glur4
MMRRC Submission 042777-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.690) question?
Stock # R5202 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4424330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 845 (K845R)
Ref Sequence ENSEMBL: ENSMUSP00000148533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably benign
Transcript: ENSMUST00000027020
AA Change: K845R

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: K845R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063508
AA Change: K845R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: K845R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212533
AA Change: K845R

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,562,308 (GRCm39) M312L probably benign Het
Adam7 C A 14: 68,745,305 (GRCm39) D640Y possibly damaging Het
Alcam T C 16: 52,094,599 (GRCm39) Y384C probably damaging Het
Apob A G 12: 8,063,737 (GRCm39) E289G probably damaging Het
Arhgap15 A T 2: 43,953,869 (GRCm39) R198S probably benign Het
Bbs2 G T 8: 94,819,042 (GRCm39) S109* probably null Het
Bfsp1 T C 2: 143,668,891 (GRCm39) S569G probably benign Het
Chst9 A T 18: 15,586,296 (GRCm39) I89N probably benign Het
Cntln A C 4: 84,889,466 (GRCm39) E316D probably benign Het
Csde1 T G 3: 102,947,250 (GRCm39) D67E probably damaging Het
Csf2rb T G 15: 78,233,257 (GRCm39) S855A possibly damaging Het
Cyp4a10 T A 4: 115,389,812 (GRCm39) D472E probably damaging Het
Cyp4f18 C A 8: 72,762,940 (GRCm39) R49L probably benign Het
Daam1 G T 12: 71,991,048 (GRCm39) V221L unknown Het
Dbr1 T G 9: 99,465,944 (GRCm39) D507E probably benign Het
Dhrs7c A G 11: 67,706,627 (GRCm39) M188V probably benign Het
Dicer1 A T 12: 104,660,990 (GRCm39) L1688* probably null Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
E2f3 G A 13: 30,102,619 (GRCm39) T91I probably damaging Het
Etaa1 A T 11: 17,897,853 (GRCm39) V157E probably damaging Het
Foxp2 A T 6: 15,394,770 (GRCm39) T157S probably benign Het
Frem2 A G 3: 53,458,767 (GRCm39) V2034A probably benign Het
Fzd10 T C 5: 128,679,180 (GRCm39) V300A possibly damaging Het
Gbf1 A T 19: 46,256,893 (GRCm39) M778L probably benign Het
Gm17472 T A 6: 42,958,068 (GRCm39) N112K probably benign Het
Hspa4l T A 3: 40,736,001 (GRCm39) S541T probably benign Het
Igkv4-68 G A 6: 69,281,926 (GRCm39) R82C probably damaging Het
Itgb1 A T 8: 129,446,491 (GRCm39) I383F probably damaging Het
Kcnk12 T A 17: 88,054,033 (GRCm39) K210* probably null Het
Limch1 C G 5: 67,150,516 (GRCm39) D163E probably damaging Het
Mbd4 A T 6: 115,826,363 (GRCm39) D188E probably damaging Het
Myh9 C T 15: 77,665,310 (GRCm39) probably null Het
Nbeal2 T C 9: 110,473,734 (GRCm39) E28G probably damaging Het
Nfatc4 A G 14: 56,064,116 (GRCm39) E201G probably damaging Het
Nrap G A 19: 56,323,583 (GRCm39) H1330Y probably damaging Het
Nudt14 A G 12: 112,898,648 (GRCm39) S151P probably damaging Het
Or14c45 C A 7: 86,176,324 (GRCm39) R120S probably damaging Het
Or2ag2 T A 7: 106,485,803 (GRCm39) T74S possibly damaging Het
Or7e165 T A 9: 19,694,514 (GRCm39) F28L possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Paqr9 A G 9: 95,442,163 (GRCm39) D51G probably damaging Het
Pcgf5 T A 19: 36,414,583 (GRCm39) F80I probably damaging Het
Pkhd1 T G 1: 20,617,565 (GRCm39) S1007R probably benign Het
Rab30 T C 7: 92,485,121 (GRCm39) Y196H probably benign Het
Setd2 A T 9: 110,380,298 (GRCm39) D1371V probably damaging Het
Slc48a1 A T 15: 97,688,581 (GRCm39) I140F possibly damaging Het
Sorl1 A G 9: 41,944,879 (GRCm39) V882A probably benign Het
Sptbn2 G T 19: 4,774,212 (GRCm39) G88W probably damaging Het
Tdrd12 A G 7: 35,189,455 (GRCm39) V427A possibly damaging Het
Tekt2 T C 4: 126,218,463 (GRCm39) D69G probably benign Het
Tie1 C T 4: 118,337,707 (GRCm39) V463I probably benign Het
Tmem150c G T 5: 100,227,813 (GRCm39) H217N probably damaging Het
Tnks2 G A 19: 36,866,252 (GRCm39) G1080R probably damaging Het
Ttll4 G A 1: 74,727,011 (GRCm39) probably null Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4,472,202 (GRCm39) missense probably damaging 0.98
IGL01451:Gria4 APN 9 4,503,652 (GRCm39) missense probably benign 0.04
IGL01533:Gria4 APN 9 4,502,395 (GRCm39) missense probably damaging 1.00
IGL01994:Gria4 APN 9 4,537,726 (GRCm39) missense probably damaging 1.00
IGL02078:Gria4 APN 9 4,793,878 (GRCm39) missense probably damaging 0.98
IGL02183:Gria4 APN 9 4,502,460 (GRCm39) missense probably damaging 1.00
IGL02351:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4,793,804 (GRCm39) splice site probably benign
IGL03131:Gria4 APN 9 4,432,876 (GRCm39) missense probably damaging 0.96
IGL03148:Gria4 APN 9 4,464,295 (GRCm39) missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4,513,288 (GRCm39) missense probably benign
PIT4812001:Gria4 UTSW 9 4,427,128 (GRCm39) missense probably damaging 1.00
R0018:Gria4 UTSW 9 4,432,843 (GRCm39) missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4,793,840 (GRCm39) missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4,464,372 (GRCm39) missense probably benign 0.32
R0690:Gria4 UTSW 9 4,427,071 (GRCm39) missense probably damaging 1.00
R0992:Gria4 UTSW 9 4,795,238 (GRCm39) missense probably benign
R1517:Gria4 UTSW 9 4,793,865 (GRCm39) missense probably damaging 1.00
R1673:Gria4 UTSW 9 4,537,637 (GRCm39) nonsense probably null
R1713:Gria4 UTSW 9 4,424,448 (GRCm39) missense probably benign 0.20
R1961:Gria4 UTSW 9 4,519,546 (GRCm39) splice site probably benign
R2137:Gria4 UTSW 9 4,427,026 (GRCm39) intron probably benign
R2397:Gria4 UTSW 9 4,537,717 (GRCm39) missense probably damaging 1.00
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R3014:Gria4 UTSW 9 4,464,294 (GRCm39) missense probably damaging 0.97
R3412:Gria4 UTSW 9 4,513,278 (GRCm39) missense probably benign 0.00
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3733:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3897:Gria4 UTSW 9 4,513,260 (GRCm39) missense probably damaging 1.00
R4404:Gria4 UTSW 9 4,464,489 (GRCm39) splice site probably null
R4457:Gria4 UTSW 9 4,427,074 (GRCm39) missense probably damaging 1.00
R4672:Gria4 UTSW 9 4,664,981 (GRCm39) missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4,464,295 (GRCm39) missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4,472,176 (GRCm39) missense probably benign 0.01
R5109:Gria4 UTSW 9 4,472,168 (GRCm39) missense probably damaging 1.00
R5828:Gria4 UTSW 9 4,432,832 (GRCm39) missense probably damaging 1.00
R5945:Gria4 UTSW 9 4,456,122 (GRCm39) missense probably damaging 1.00
R5985:Gria4 UTSW 9 4,503,593 (GRCm39) missense probably damaging 0.99
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6111:Gria4 UTSW 9 4,502,430 (GRCm39) missense probably damaging 1.00
R6190:Gria4 UTSW 9 4,420,199 (GRCm39) missense probably benign
R6280:Gria4 UTSW 9 4,456,072 (GRCm39) missense probably damaging 1.00
R6406:Gria4 UTSW 9 4,427,077 (GRCm39) missense probably damaging 1.00
R6470:Gria4 UTSW 9 4,503,680 (GRCm39) missense probably damaging 1.00
R6485:Gria4 UTSW 9 4,464,249 (GRCm39) missense probably damaging 1.00
R6612:Gria4 UTSW 9 4,472,206 (GRCm39) missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4,793,822 (GRCm39) missense probably damaging 1.00
R7046:Gria4 UTSW 9 4,420,278 (GRCm39) missense probably damaging 0.97
R7210:Gria4 UTSW 9 4,464,135 (GRCm39) missense probably damaging 1.00
R7284:Gria4 UTSW 9 4,472,017 (GRCm39) missense probably damaging 1.00
R7475:Gria4 UTSW 9 4,513,330 (GRCm39) missense probably damaging 1.00
R7501:Gria4 UTSW 9 4,502,436 (GRCm39) missense probably benign 0.01
R7536:Gria4 UTSW 9 4,464,298 (GRCm39) missense probably damaging 1.00
R7604:Gria4 UTSW 9 4,464,315 (GRCm39) missense probably damaging 1.00
R7643:Gria4 UTSW 9 4,793,950 (GRCm39) missense probably benign 0.00
R7669:Gria4 UTSW 9 4,462,029 (GRCm39) missense probably damaging 1.00
R7703:Gria4 UTSW 9 4,503,588 (GRCm39) missense probably benign
R7720:Gria4 UTSW 9 4,464,288 (GRCm39) missense probably damaging 1.00
R7724:Gria4 UTSW 9 4,472,074 (GRCm39) missense probably damaging 1.00
R7909:Gria4 UTSW 9 4,464,450 (GRCm39) missense probably damaging 1.00
R8007:Gria4 UTSW 9 4,503,740 (GRCm39) splice site probably benign
R8044:Gria4 UTSW 9 4,456,216 (GRCm39) missense probably damaging 1.00
R8062:Gria4 UTSW 9 4,480,273 (GRCm39) missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4,502,429 (GRCm39) missense probably benign 0.16
R8212:Gria4 UTSW 9 4,480,242 (GRCm39) missense probably benign
R8478:Gria4 UTSW 9 4,793,882 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,351 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,347 (GRCm39) missense probably damaging 1.00
R8785:Gria4 UTSW 9 4,795,189 (GRCm39) missense possibly damaging 0.92
R8785:Gria4 UTSW 9 4,456,106 (GRCm39) missense probably damaging 1.00
R8888:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R8895:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R9160:Gria4 UTSW 9 4,424,412 (GRCm39) missense probably damaging 1.00
R9498:Gria4 UTSW 9 4,503,560 (GRCm39) critical splice donor site probably null
R9743:Gria4 UTSW 9 4,464,457 (GRCm39) missense probably damaging 1.00
X0023:Gria4 UTSW 9 4,427,067 (GRCm39) missense probably damaging 1.00
X0065:Gria4 UTSW 9 4,464,340 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACCGTGTTCACAGGATGCATC -3'
(R):5'- CCTGCATCAGCGACTTATACC -3'

Sequencing Primer
(F):5'- GATGCATCCCCCGCTCAC -3'
(R):5'- GGCTATTTGGATATTATGCATCCC -3'
Posted On 2016-07-06