Incidental Mutation 'R5242:Tas2r124'
ID400912
Institutional Source Beutler Lab
Gene Symbol Tas2r124
Ensembl Gene ENSMUSG00000060412
Gene Nametaste receptor, type 2, member 124
SynonymsT2R24, mGR24, mt2r50, Tas2r24
MMRRC Submission 042813-MU
Accession Numbers

NCBI RefSeq: NM_207026.1; MGI:2681267

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5242 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132754730-132755659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132755540 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 271 (Y271H)
Ref Sequence ENSEMBL: ENSMUSP00000075509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076150
AA Change: Y271H

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075509
Gene: ENSMUSG00000060412
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 2.3e-92 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A G 8: 36,511,930 K229R probably benign Het
Adgrl1 T C 8: 83,931,082 V439A possibly damaging Het
Aldh6a1 A G 12: 84,436,383 V390A probably damaging Het
Alox5 T C 6: 116,460,966 D20G probably damaging Het
Atp2a2 A T 5: 122,461,946 F487I probably damaging Het
BC048679 G A 7: 81,495,343 T84M probably damaging Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdh6 A G 15: 13,064,411 V131A probably benign Het
Chrna9 A G 5: 65,977,080 T425A probably benign Het
Ddx39 A G 8: 83,721,811 S231G probably benign Het
Diaph1 C T 18: 37,851,635 G1176R probably damaging Het
Dnah10 G T 5: 124,787,420 V2230L probably benign Het
Foxo1 T C 3: 52,269,255 S152P probably damaging Het
Fras1 T A 5: 96,657,250 D1250E probably benign Het
G6pd2 A G 5: 61,809,442 I187V probably benign Het
Gm10113 T C 13: 46,177,516 noncoding transcript Het
Gm13088 A T 4: 143,655,611 L172I probably benign Het
Hoxd1 A G 2: 74,763,448 D116G probably damaging Het
Igkv13-85 A T 6: 68,930,560 I19K probably benign Het
Jag2 C T 12: 112,916,866 V288M probably damaging Het
Ndrg2 A G 14: 51,911,084 probably null Het
Neurl3 G A 1: 36,269,420 Q104* probably null Het
Nudt16l1 C T 16: 4,939,621 R133W probably damaging Het
Oasl2 A T 5: 114,905,061 Q298L possibly damaging Het
Olfr139 A T 11: 74,045,022 M84K possibly damaging Het
Olfr559 C T 7: 102,724,276 M71I probably benign Het
Pnma2 C A 14: 66,916,297 Q57K probably benign Het
Rps7 T A 12: 28,631,137 E188D probably benign Het
Rrp1b T C 17: 32,051,703 V212A possibly damaging Het
Rsg1 T C 4: 141,219,847 Y180H probably damaging Het
Serpina9 C A 12: 104,008,385 A170S probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Siae C T 9: 37,644,852 P435S probably damaging Het
Smarcal1 T C 1: 72,591,083 S99P probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Thsd7a A T 6: 12,327,583 I1430K probably damaging Het
Tmem110 T A 14: 30,825,836 F36I probably damaging Het
Tsc22d2 T A 3: 58,415,939 V84E possibly damaging Het
Ube2s C T 7: 4,810,435 R110Q possibly damaging Het
Usp3 C T 9: 66,527,150 C283Y probably damaging Het
Vmn2r81 T A 10: 79,293,475 Y733* probably null Het
Wdr75 T A 1: 45,817,327 C503* probably null Het
Zfp764 T C 7: 127,405,369 M197V probably benign Het
Other mutations in Tas2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tas2r124 APN 6 132755529 missense probably benign 0.02
IGL01343:Tas2r124 APN 6 132755415 missense probably damaging 1.00
IGL01646:Tas2r124 APN 6 132755369 missense probably damaging 0.98
IGL01743:Tas2r124 APN 6 132754835 missense probably benign 0.01
IGL02251:Tas2r124 APN 6 132755561 missense probably benign 0.02
IGL03081:Tas2r124 APN 6 132755534 missense possibly damaging 0.61
IGL03309:Tas2r124 APN 6 132754935 missense probably benign 0.01
IGL03374:Tas2r124 APN 6 132755118 missense probably benign 0.00
P0012:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R1450:Tas2r124 UTSW 6 132755056 missense probably damaging 1.00
R1804:Tas2r124 UTSW 6 132755525 missense probably benign 0.11
R2048:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R2846:Tas2r124 UTSW 6 132755267 missense possibly damaging 0.73
R3415:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3416:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3417:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R4306:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4308:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4823:Tas2r124 UTSW 6 132755546 missense probably damaging 0.98
R4867:Tas2r124 UTSW 6 132755193 missense probably damaging 0.98
R4949:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R6001:Tas2r124 UTSW 6 132755453 missense probably damaging 0.99
R6263:Tas2r124 UTSW 6 132754904 missense probably benign 0.45
R6313:Tas2r124 UTSW 6 132755447 missense probably benign 0.00
R6394:Tas2r124 UTSW 6 132755076 missense probably damaging 1.00
R7685:Tas2r124 UTSW 6 132755093 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGATGCCACTCAATTCTAGAGGAG -3'
(R):5'- CCTGCTACTCCATGTCAAGG -3'

Sequencing Primer
(F):5'- GATAGAGACCCTAGTGCTACGGC -3'
(R):5'- CTACTCCATGTCAAGGGGAAAAATG -3'
Posted On2016-07-06