Incidental Mutation 'R5242:Siae'
ID400930
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
MMRRC Submission 042813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5242 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37644852 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 435 (P435S)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000117654] [ENSMUST00000142736] [ENSMUST00000213126] [ENSMUST00000215474]
Predicted Effect probably damaging
Transcript: ENSMUST00000002007
AA Change: P363S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942
AA Change: P363S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117654
SMART Domains Protein: ENSMUSP00000112600
Gene: ENSMUSG00000011114

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
coiled coil region 56 79 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 124 156 N/A INTRINSIC
FYRN 192 235 1.05e-18 SMART
Pfam:FYRC 238 316 1.4e-23 PFAM
low complexity region 349 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142736
Predicted Effect probably damaging
Transcript: ENSMUST00000213126
AA Change: P400S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000213964
AA Change: P73S
Predicted Effect probably damaging
Transcript: ENSMUST00000215474
AA Change: P435S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A G 8: 36,511,930 K229R probably benign Het
Adgrl1 T C 8: 83,931,082 V439A possibly damaging Het
Aldh6a1 A G 12: 84,436,383 V390A probably damaging Het
Alox5 T C 6: 116,460,966 D20G probably damaging Het
Atp2a2 A T 5: 122,461,946 F487I probably damaging Het
BC048679 G A 7: 81,495,343 T84M probably damaging Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdh6 A G 15: 13,064,411 V131A probably benign Het
Chrna9 A G 5: 65,977,080 T425A probably benign Het
Ddx39 A G 8: 83,721,811 S231G probably benign Het
Diaph1 C T 18: 37,851,635 G1176R probably damaging Het
Dnah10 G T 5: 124,787,420 V2230L probably benign Het
Foxo1 T C 3: 52,269,255 S152P probably damaging Het
Fras1 T A 5: 96,657,250 D1250E probably benign Het
G6pd2 A G 5: 61,809,442 I187V probably benign Het
Gm10113 T C 13: 46,177,516 noncoding transcript Het
Gm13088 A T 4: 143,655,611 L172I probably benign Het
Hoxd1 A G 2: 74,763,448 D116G probably damaging Het
Igkv13-85 A T 6: 68,930,560 I19K probably benign Het
Jag2 C T 12: 112,916,866 V288M probably damaging Het
Ndrg2 A G 14: 51,911,084 probably null Het
Neurl3 G A 1: 36,269,420 Q104* probably null Het
Nudt16l1 C T 16: 4,939,621 R133W probably damaging Het
Oasl2 A T 5: 114,905,061 Q298L possibly damaging Het
Olfr139 A T 11: 74,045,022 M84K possibly damaging Het
Olfr559 C T 7: 102,724,276 M71I probably benign Het
Pnma2 C A 14: 66,916,297 Q57K probably benign Het
Rps7 T A 12: 28,631,137 E188D probably benign Het
Rrp1b T C 17: 32,051,703 V212A possibly damaging Het
Rsg1 T C 4: 141,219,847 Y180H probably damaging Het
Serpina9 C A 12: 104,008,385 A170S probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Smarcal1 T C 1: 72,591,083 S99P probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tas2r124 T C 6: 132,755,540 Y271H possibly damaging Het
Thsd7a A T 6: 12,327,583 I1430K probably damaging Het
Tmem110 T A 14: 30,825,836 F36I probably damaging Het
Tsc22d2 T A 3: 58,415,939 V84E possibly damaging Het
Ube2s C T 7: 4,810,435 R110Q possibly damaging Het
Usp3 C T 9: 66,527,150 C283Y probably damaging Het
Vmn2r81 T A 10: 79,293,475 Y733* probably null Het
Wdr75 T A 1: 45,817,327 C503* probably null Het
Zfp764 T C 7: 127,405,369 M197V probably benign Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7697:Siae UTSW 9 37633654 missense probably damaging 1.00
R7821:Siae UTSW 9 37644900 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8312:Siae UTSW 9 37646297 missense
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
R8868:Siae UTSW 9 37616836 missense probably damaging 1.00
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTATCCTTGAGTGCTCTGAATGC -3'
(R):5'- AGTAGTTGTGCATTTGGCCC -3'

Sequencing Primer
(F):5'- GAGTGCTCTGAATGCTCTCC -3'
(R):5'- CATTTGGCCCTCTGAGATGAGC -3'
Posted On2016-07-06