Mutagenetix > Incidental Mutation

Incidental Mutation 'R5202:Csf2rb'

400935

Institutional Source

Beutler Lab

Gene Symbol

Csf2rb

Ensembl Gene

ENSMUSG00000071713

Gene Name

colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

Synonyms

Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131

MMRRC Submission

042777-MU

Accession Numbers

Genbank: NM_007780; MGI: 1339759

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78325752-78353847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 78349057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 855 (S855A)

Ref Sequence

ENSEMBL: ENSMUSP00000154836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264]

AlphaFold

P26955

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096355
AA Change: S855A

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: S855A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SCOP:d1gh7a1	29	130	6e-58	SMART
FN3	136	224	4.44e0	SMART
Blast:FN3	245	338	3e-24	BLAST
SCOP:d1gh7a3	245	338	2e-45	SMART
FN3	343	426	2.41e0	SMART
transmembrane domain	446	468	N/A	INTRINSIC
low complexity region	716	743	N/A	INTRINSIC
low complexity region	824	845	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183523

Predicted Effect

probably benign
Transcript: ENSMUST00000229678

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230264
AA Change: S855A

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,731,964	M312L	probably benign	Het
Adam7	C	A	14: 68,507,856	D640Y	possibly damaging	Het
Alcam	T	C	16: 52,274,236	Y384C	probably damaging	Het
Apob	A	G	12: 8,013,737	E289G	probably damaging	Het
Arhgap15	A	T	2: 44,063,857	R198S	probably benign	Het
Bbs2	G	T	8: 94,092,414	S109*	probably null	Het
Bfsp1	T	C	2: 143,826,971	S569G	probably benign	Het
Chst9	A	T	18: 15,453,239	I89N	probably benign	Het
Cntln	A	C	4: 84,971,229	E316D	probably benign	Het
Csde1	T	G	3: 103,039,934	D67E	probably damaging	Het
Cyp4a10	T	A	4: 115,532,615	D472E	probably damaging	Het
Cyp4f18	C	A	8: 72,009,096	R49L	probably benign	Het
Daam1	G	T	12: 71,944,274	V221L	unknown	Het
Dbr1	T	G	9: 99,583,891	D507E	probably benign	Het
Dhrs7c	A	G	11: 67,815,801	M188V	probably benign	Het
Dicer1	A	T	12: 104,694,731	L1688*	probably null	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
E2f3	G	A	13: 29,918,636	T91I	probably damaging	Het
Etaa1	A	T	11: 17,947,853	V157E	probably damaging	Het
Foxp2	A	T	6: 15,394,771	T157S	probably benign	Het
Frem2	A	G	3: 53,551,346	V2034A	probably benign	Het
Fzd10	T	C	5: 128,602,116	V300A	possibly damaging	Het
Gbf1	A	T	19: 46,268,454	M778L	probably benign	Het
Gm17472	T	A	6: 42,981,134	N112K	probably benign	Het
Gria4	T	C	9: 4,424,330	K845R	probably benign	Het
Hspa4l	T	A	3: 40,781,569	S541T	probably benign	Het
Igkv4-68	G	A	6: 69,304,942	R82C	probably damaging	Het
Itgb1	A	T	8: 128,720,010	I383F	probably damaging	Het
Kcnk12	T	A	17: 87,746,605	K210*	probably null	Het
Limch1	C	G	5: 66,993,173	D163E	probably damaging	Het
Mbd4	A	T	6: 115,849,402	D188E	probably damaging	Het
Myh9	C	T	15: 77,781,110		probably null	Het
Nbeal2	T	C	9: 110,644,666	E28G	probably damaging	Het
Nfatc4	A	G	14: 55,826,659	E201G	probably damaging	Het
Nrap	G	A	19: 56,335,151	H1330Y	probably damaging	Het
Nudt14	A	G	12: 112,935,028	S151P	probably damaging	Het
Olfr297	C	A	7: 86,527,116	R120S	probably damaging	Het
Olfr58	T	A	9: 19,783,218	F28L	possibly damaging	Het
Olfr706	T	A	7: 106,886,596	T74S	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Paqr9	A	G	9: 95,560,110	D51G	probably damaging	Het
Pcgf5	T	A	19: 36,437,183	F80I	probably damaging	Het
Pkhd1	T	G	1: 20,547,341	S1007R	probably benign	Het
Rab30	T	C	7: 92,835,913	Y196H	probably benign	Het
Setd2	A	T	9: 110,551,230	D1371V	probably damaging	Het
Slc48a1	A	T	15: 97,790,700	I140F	possibly damaging	Het
Sorl1	A	G	9: 42,033,583	V882A	probably benign	Het
Sptbn2	G	T	19: 4,724,184	G88W	probably damaging	Het
Tdrd12	A	G	7: 35,490,030	V427A	possibly damaging	Het
Tekt2	T	C	4: 126,324,670	D69G	probably benign	Het
Tie1	C	T	4: 118,480,510	V463I	probably benign	Het
Tmem150c	G	T	5: 100,079,954	H217N	probably damaging	Het
Tnks2	G	A	19: 36,888,852	G1080R	probably damaging	Het
Ttll4	G	A	1: 74,687,852		probably null	Het

Other mutations in Csf2rb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Csf2rb	APN	15	78348514	nonsense	probably null
IGL00979:Csf2rb	APN	15	78348104	missense	probably damaging	1.00
IGL01613:Csf2rb	APN	15	78335302	intron	probably benign
IGL01724:Csf2rb	APN	15	78336414	missense	probably damaging	1.00
IGL01942:Csf2rb	APN	15	78340492	missense	probably benign
IGL02479:Csf2rb	APN	15	78341724	nonsense	probably null
3-1:Csf2rb	UTSW	15	78344603	missense	probably damaging	1.00
IGL02802:Csf2rb	UTSW	15	78338903	missense	probably benign	0.00
R0133:Csf2rb	UTSW	15	78339004	unclassified	probably benign
R0179:Csf2rb	UTSW	15	78336372	missense	possibly damaging	0.52
R0487:Csf2rb	UTSW	15	78348331	missense	probably benign	0.00
R1544:Csf2rb	UTSW	15	78340755	missense	probably benign	0.02
R1619:Csf2rb	UTSW	15	78335211	missense	probably damaging	0.99
R1690:Csf2rb	UTSW	15	78348644	missense	probably benign	0.11
R1831:Csf2rb	UTSW	15	78348253	missense	probably benign	0.03
R3970:Csf2rb	UTSW	15	78341467	missense	probably benign
R4922:Csf2rb	UTSW	15	78346467	missense	probably benign	0.02
R5151:Csf2rb	UTSW	15	78340581	missense	probably damaging	1.00
R5398:Csf2rb	UTSW	15	78348620	missense	probably benign
R5496:Csf2rb	UTSW	15	78340561	missense	probably damaging	1.00
R5786:Csf2rb	UTSW	15	78348955	missense	probably damaging	1.00
R6166:Csf2rb	UTSW	15	78344566	missense	probably damaging	1.00
R6347:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6350:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6899:Csf2rb	UTSW	15	78340702	missense	probably benign	0.01
R6984:Csf2rb	UTSW	15	78345519	missense	probably damaging	1.00
R7484:Csf2rb	UTSW	15	78338899	missense	possibly damaging	0.53
R7671:Csf2rb	UTSW	15	78338930	missense	probably damaging	1.00
R7751:Csf2rb	UTSW	15	78341639	missense	probably damaging	1.00
R7781:Csf2rb	UTSW	15	78344571	missense	probably benign	0.00
R7861:Csf2rb	UTSW	15	78349157	missense	probably damaging	1.00
R8135:Csf2rb	UTSW	15	78348119	missense	possibly damaging	0.95
R8154:Csf2rb	UTSW	15	78340442	critical splice acceptor site	probably null
R8299:Csf2rb	UTSW	15	78346469	missense	possibly damaging	0.88
R8315:Csf2rb	UTSW	15	78347381	missense	possibly damaging	0.83
R8926:Csf2rb	UTSW	15	78340549	missense	probably benign
R8948:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R8950:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R9265:Csf2rb	UTSW	15	78348546	missense	probably benign	0.08
R9510:Csf2rb	UTSW	15	78345560	critical splice donor site	probably null
R9755:Csf2rb	UTSW	15	78348624	nonsense	probably null
X0024:Csf2rb	UTSW	15	78336360	missense	probably damaging	1.00
X0028:Csf2rb	UTSW	15	78349002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGACTATGTGGAGCTGC -3'
(R):5'- AACTCAGAGAGGCTTCTGTGG -3'

Sequencing Primer
(F):5'- AGCTGCCTCCAAGTGTGAG -3'
(R):5'- TCAGGCTGAGGACCACAG -3'

Posted On

2016-07-06