Incidental Mutation 'R5202:Alcam'
ID400941
Institutional Source Beutler Lab
Gene Symbol Alcam
Ensembl Gene ENSMUSG00000022636
Gene Nameactivated leukocyte cell adhesion molecule
SynonymsSC1, BEN, MuSC, DM-GRASP, CD166
MMRRC Submission 042777-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R5202 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location52248996-52454074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52274236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 384 (Y384C)
Ref Sequence ENSEMBL: ENSMUSP00000129714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023312] [ENSMUST00000164728] [ENSMUST00000170035]
Predicted Effect probably damaging
Transcript: ENSMUST00000023312
AA Change: Y384C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023312
Gene: ENSMUSG00000022636
AA Change: Y384C

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 5.1e-24 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 489 3.8e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164728
AA Change: Y384C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127141
Gene: ENSMUSG00000022636
AA Change: Y384C

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 1e-22 PFAM
Pfam:Ig_2 147 235 3.8e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 496 1.9e-7 PFAM
Pfam:Ig_2 415 502 1.5e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164888
Predicted Effect unknown
Transcript: ENSMUST00000167115
AA Change: Y145C
SMART Domains Protein: ENSMUSP00000130563
Gene: ENSMUSG00000022636
AA Change: Y145C

DomainStartEndE-ValueType
Pfam:C2-set_2 1 80 3.6e-21 PFAM
IG 101 175 6.26e-5 SMART
Pfam:Ig_3 177 251 1.7e-6 PFAM
transmembrane domain 290 312 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170035
AA Change: Y384C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129714
Gene: ENSMUSG00000022636
AA Change: Y384C

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 3.4e-23 PFAM
Pfam:Ig_2 147 235 1.3e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 491 5.9e-8 PFAM
Pfam:Ig_2 415 502 4.9e-7 PFAM
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display abnormal motor neuron and retinal ganglion cell morphology and retinal dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,731,964 M312L probably benign Het
Adam7 C A 14: 68,507,856 D640Y possibly damaging Het
Apob A G 12: 8,013,737 E289G probably damaging Het
Arhgap15 A T 2: 44,063,857 R198S probably benign Het
Bbs2 G T 8: 94,092,414 S109* probably null Het
Bfsp1 T C 2: 143,826,971 S569G probably benign Het
Chst9 A T 18: 15,453,239 I89N probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Csde1 T G 3: 103,039,934 D67E probably damaging Het
Csf2rb T G 15: 78,349,057 S855A possibly damaging Het
Cyp4a10 T A 4: 115,532,615 D472E probably damaging Het
Cyp4f18 C A 8: 72,009,096 R49L probably benign Het
Daam1 G T 12: 71,944,274 V221L unknown Het
Dbr1 T G 9: 99,583,891 D507E probably benign Het
Dhrs7c A G 11: 67,815,801 M188V probably benign Het
Dicer1 A T 12: 104,694,731 L1688* probably null Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
E2f3 G A 13: 29,918,636 T91I probably damaging Het
Etaa1 A T 11: 17,947,853 V157E probably damaging Het
Foxp2 A T 6: 15,394,771 T157S probably benign Het
Frem2 A G 3: 53,551,346 V2034A probably benign Het
Fzd10 T C 5: 128,602,116 V300A possibly damaging Het
Gbf1 A T 19: 46,268,454 M778L probably benign Het
Gm17472 T A 6: 42,981,134 N112K probably benign Het
Gria4 T C 9: 4,424,330 K845R probably benign Het
Hspa4l T A 3: 40,781,569 S541T probably benign Het
Igkv4-68 G A 6: 69,304,942 R82C probably damaging Het
Itgb1 A T 8: 128,720,010 I383F probably damaging Het
Kcnk12 T A 17: 87,746,605 K210* probably null Het
Limch1 C G 5: 66,993,173 D163E probably damaging Het
Mbd4 A T 6: 115,849,402 D188E probably damaging Het
Myh9 C T 15: 77,781,110 probably null Het
Nbeal2 T C 9: 110,644,666 E28G probably damaging Het
Nfatc4 A G 14: 55,826,659 E201G probably damaging Het
Nrap G A 19: 56,335,151 H1330Y probably damaging Het
Nudt14 A G 12: 112,935,028 S151P probably damaging Het
Olfr297 C A 7: 86,527,116 R120S probably damaging Het
Olfr58 T A 9: 19,783,218 F28L possibly damaging Het
Olfr706 T A 7: 106,886,596 T74S possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr9 A G 9: 95,560,110 D51G probably damaging Het
Pcgf5 T A 19: 36,437,183 F80I probably damaging Het
Pkhd1 T G 1: 20,547,341 S1007R probably benign Het
Rab30 T C 7: 92,835,913 Y196H probably benign Het
Setd2 A T 9: 110,551,230 D1371V probably damaging Het
Slc48a1 A T 15: 97,790,700 I140F possibly damaging Het
Sorl1 A G 9: 42,033,583 V882A probably benign Het
Sptbn2 G T 19: 4,724,184 G88W probably damaging Het
Tdrd12 A G 7: 35,490,030 V427A possibly damaging Het
Tekt2 T C 4: 126,324,670 D69G probably benign Het
Tie1 C T 4: 118,480,510 V463I probably benign Het
Tmem150c G T 5: 100,079,954 H217N probably damaging Het
Tnks2 G A 19: 36,888,852 G1080R probably damaging Het
Ttll4 G A 1: 74,687,852 probably null Het
Other mutations in Alcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Alcam APN 16 52295017 splice site probably benign
IGL00737:Alcam APN 16 52253180 missense unknown
IGL01514:Alcam APN 16 52274290 splice site probably benign
IGL01837:Alcam APN 16 52253168 missense probably benign 0.10
IGL02143:Alcam APN 16 52305619 missense probably damaging 0.99
IGL02231:Alcam APN 16 52274050 splice site probably benign
IGL02375:Alcam APN 16 52288936 missense probably benign 0.00
IGL02579:Alcam APN 16 52270772 missense probably damaging 1.00
IGL02678:Alcam APN 16 52274038 missense probably damaging 1.00
IGL02798:Alcam APN 16 52305639 missense probably damaging 1.00
IGL02974:Alcam APN 16 52295716 missense probably benign 0.05
IGL03335:Alcam APN 16 52291003 nonsense probably null
PIT4402001:Alcam UTSW 16 52295134 missense probably damaging 1.00
PIT4651001:Alcam UTSW 16 52295187 missense probably benign
R0282:Alcam UTSW 16 52295741 missense probably damaging 0.99
R0395:Alcam UTSW 16 52309864 missense probably benign 0.42
R0760:Alcam UTSW 16 52295672 missense probably benign 0.32
R0882:Alcam UTSW 16 52253210 missense possibly damaging 0.47
R1433:Alcam UTSW 16 52295752 critical splice acceptor site probably null
R1677:Alcam UTSW 16 52270773 missense probably damaging 1.00
R1751:Alcam UTSW 16 52270714 missense probably damaging 1.00
R1767:Alcam UTSW 16 52270714 missense probably damaging 1.00
R2440:Alcam UTSW 16 52305613 missense probably damaging 1.00
R2963:Alcam UTSW 16 52295041 missense probably benign 0.00
R3410:Alcam UTSW 16 52309898 missense probably null 0.03
R4327:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4328:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4888:Alcam UTSW 16 52268813 missense probably benign 0.03
R5088:Alcam UTSW 16 52288927 missense probably damaging 1.00
R5208:Alcam UTSW 16 52295048 nonsense probably null
R5278:Alcam UTSW 16 52274275 missense probably benign
R5799:Alcam UTSW 16 52309849 missense probably benign 0.28
R5909:Alcam UTSW 16 52290993 missense probably benign
R5960:Alcam UTSW 16 52295126 missense probably benign 0.30
R6194:Alcam UTSW 16 52268398 missense probably damaging 1.00
R6434:Alcam UTSW 16 52288827 intron probably null
R6831:Alcam UTSW 16 52309901 missense probably benign 0.00
R6868:Alcam UTSW 16 52268385 missense probably damaging 1.00
R6930:Alcam UTSW 16 52305655 missense probably benign 0.14
R6957:Alcam UTSW 16 52276894 missense probably damaging 1.00
R7109:Alcam UTSW 16 52276829 missense probably damaging 0.98
R7473:Alcam UTSW 16 52452519 unclassified probably benign
R7562:Alcam UTSW 16 52268823 missense probably benign 0.00
R7568:Alcam UTSW 16 52268386 missense probably damaging 1.00
R7631:Alcam UTSW 16 52288913 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGTGGCAGATTATAGTTTTAGACAG -3'
(R):5'- TAGGCGCATGTACCACACAC -3'

Sequencing Primer
(F):5'- GCAGATTATAGTTTTAGACAGTCCAC -3'
(R):5'- TAGGCGCATGTACCACACACATATAC -3'
Posted On2016-07-06