Incidental Mutation 'R5242:Jag2'
ID400948
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Namejagged 2
SynonymsSerh, D12Ggc2e
MMRRC Submission 042813-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5242 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112907819-112929776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112916866 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 288 (V288M)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
Predicted Effect probably damaging
Transcript: ENSMUST00000075827
AA Change: V288M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: V288M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222402
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A G 8: 36,511,930 K229R probably benign Het
Adgrl1 T C 8: 83,931,082 V439A possibly damaging Het
Aldh6a1 A G 12: 84,436,383 V390A probably damaging Het
Alox5 T C 6: 116,460,966 D20G probably damaging Het
Atp2a2 A T 5: 122,461,946 F487I probably damaging Het
BC048679 G A 7: 81,495,343 T84M probably damaging Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdh6 A G 15: 13,064,411 V131A probably benign Het
Chrna9 A G 5: 65,977,080 T425A probably benign Het
Ddx39 A G 8: 83,721,811 S231G probably benign Het
Diaph1 C T 18: 37,851,635 G1176R probably damaging Het
Dnah10 G T 5: 124,787,420 V2230L probably benign Het
Foxo1 T C 3: 52,269,255 S152P probably damaging Het
Fras1 T A 5: 96,657,250 D1250E probably benign Het
G6pd2 A G 5: 61,809,442 I187V probably benign Het
Gm10113 T C 13: 46,177,516 noncoding transcript Het
Gm13088 A T 4: 143,655,611 L172I probably benign Het
Hoxd1 A G 2: 74,763,448 D116G probably damaging Het
Igkv13-85 A T 6: 68,930,560 I19K probably benign Het
Ndrg2 A G 14: 51,911,084 probably null Het
Neurl3 G A 1: 36,269,420 Q104* probably null Het
Nudt16l1 C T 16: 4,939,621 R133W probably damaging Het
Oasl2 A T 5: 114,905,061 Q298L possibly damaging Het
Olfr139 A T 11: 74,045,022 M84K possibly damaging Het
Olfr559 C T 7: 102,724,276 M71I probably benign Het
Pnma2 C A 14: 66,916,297 Q57K probably benign Het
Rps7 T A 12: 28,631,137 E188D probably benign Het
Rrp1b T C 17: 32,051,703 V212A possibly damaging Het
Rsg1 T C 4: 141,219,847 Y180H probably damaging Het
Serpina9 C A 12: 104,008,385 A170S probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Siae C T 9: 37,644,852 P435S probably damaging Het
Smarcal1 T C 1: 72,591,083 S99P probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tas2r124 T C 6: 132,755,540 Y271H possibly damaging Het
Thsd7a A T 6: 12,327,583 I1430K probably damaging Het
Tmem110 T A 14: 30,825,836 F36I probably damaging Het
Tsc22d2 T A 3: 58,415,939 V84E possibly damaging Het
Ube2s C T 7: 4,810,435 R110Q possibly damaging Het
Usp3 C T 9: 66,527,150 C283Y probably damaging Het
Vmn2r81 T A 10: 79,293,475 Y733* probably null Het
Wdr75 T A 1: 45,817,327 C503* probably null Het
Zfp764 T C 7: 127,405,369 M197V probably benign Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATTGGTCAGGCTCAGCATTGATG -3'
(R):5'- CCTGCTTGGTTCAGAGCTGTTC -3'

Sequencing Primer
(F):5'- ATTGATGCAGGTACCCCCGTTG -3'
(R):5'- AGCTGTTCTCTGGGACCAC -3'
Posted On2016-07-06