Incidental Mutation 'R5243:Vmn2r5'
ID400969
Institutional Source Beutler Lab
Gene Symbol Vmn2r5
Ensembl Gene ENSMUSG00000068999
Gene Namevomeronasal 2, receptor 5
SynonymsEG667060
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64490821-64509735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64504076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 357 (D357G)
Ref Sequence ENSEMBL: ENSMUSP00000135592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]
Predicted Effect probably damaging
Transcript: ENSMUST00000170270
AA Change: D270G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999
AA Change: D270G

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 9.9e-78 PFAM
Pfam:NCD3G 458 511 8.5e-18 PFAM
Pfam:7tm_3 542 779 2.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177184
AA Change: D357G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: D357G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 86 503 1.8e-80 PFAM
Pfam:NCD3G 545 598 1e-14 PFAM
Pfam:7tm_3 631 865 1.4e-45 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in Vmn2r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Vmn2r5 APN 3 64491413 missense possibly damaging 0.67
IGL01139:Vmn2r5 APN 3 64491405 missense probably benign 0.28
IGL03293:Vmn2r5 APN 3 64491326 missense probably benign 0.01
PIT4581001:Vmn2r5 UTSW 3 64503927 nonsense probably null
R0063:Vmn2r5 UTSW 3 64503800 missense probably benign 0.01
R0142:Vmn2r5 UTSW 3 64492588 missense probably damaging 1.00
R0193:Vmn2r5 UTSW 3 64491530 missense possibly damaging 0.91
R0219:Vmn2r5 UTSW 3 64504313 missense probably damaging 0.99
R0313:Vmn2r5 UTSW 3 64503827 missense probably benign
R0620:Vmn2r5 UTSW 3 64503814 nonsense probably null
R0726:Vmn2r5 UTSW 3 64503765 missense probably benign 0.01
R1073:Vmn2r5 UTSW 3 64491305 nonsense probably null
R1549:Vmn2r5 UTSW 3 64504000 missense probably damaging 1.00
R1581:Vmn2r5 UTSW 3 64491219 missense probably damaging 1.00
R1624:Vmn2r5 UTSW 3 64509695 missense probably benign 0.19
R1973:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1974:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1975:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1977:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R2189:Vmn2r5 UTSW 3 64509593 missense probably benign 0.27
R2484:Vmn2r5 UTSW 3 64503971 missense possibly damaging 0.94
R4573:Vmn2r5 UTSW 3 64503918 missense probably damaging 0.98
R5384:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5385:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5587:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5588:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5589:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5590:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5739:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R6113:Vmn2r5 UTSW 3 64491399 missense probably benign 0.03
R6739:Vmn2r5 UTSW 3 64491216 missense probably damaging 0.97
R7106:Vmn2r5 UTSW 3 64491683 missense probably benign 0.05
R7304:Vmn2r5 UTSW 3 64504250 missense probably damaging 0.97
R7402:Vmn2r5 UTSW 3 64495755 missense probably benign 0.05
R7477:Vmn2r5 UTSW 3 64491639 missense probably damaging 1.00
R7571:Vmn2r5 UTSW 3 64504404 missense probably damaging 1.00
R7678:Vmn2r5 UTSW 3 64509522 missense probably benign
R7874:Vmn2r5 UTSW 3 64491032 missense probably damaging 1.00
R8110:Vmn2r5 UTSW 3 64491288 missense probably benign 0.00
R8223:Vmn2r5 UTSW 3 64491305 nonsense probably null
R8767:Vmn2r5 UTSW 3 64507682 missense possibly damaging 0.79
R8896:Vmn2r5 UTSW 3 64503782 missense probably benign 0.00
R8948:Vmn2r5 UTSW 3 64491101 missense probably damaging 1.00
R8950:Vmn2r5 UTSW 3 64491101 missense probably damaging 1.00
R8962:Vmn2r5 UTSW 3 64491143 missense probably damaging 1.00
Z1088:Vmn2r5 UTSW 3 64509542 missense probably benign 0.02
Z1177:Vmn2r5 UTSW 3 64491051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATACACAGCTTGTCTGACATTG -3'
(R):5'- TAACTCACAGGACATGGATAGCC -3'

Sequencing Primer
(F):5'- CTTAGCTGAGATGTATCCAGATAGG -3'
(R):5'- GCTCTCATTGCAAAGCCT -3'
Posted On2016-07-06