Incidental Mutation 'R5243:Slc7a5'
ID400995
Institutional Source Beutler Lab
Gene Symbol Slc7a5
Ensembl Gene ENSMUSG00000040010
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 5
SynonymsTA1, D0H16S474E, LAT1
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121881150-121907694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121896535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 191 (V191A)
Ref Sequence ENSEMBL: ENSMUSP00000041557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045557] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000045557
AA Change: V191A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041557
Gene: ENSMUSG00000040010
AA Change: V191A

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:AA_permease_2 51 481 4.2e-65 PFAM
Pfam:AA_permease 56 489 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183015
Meta Mutation Damage Score 0.9362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in Slc7a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Slc7a5 APN 8 121886390 intron probably benign
R0364:Slc7a5 UTSW 8 121885015 missense probably benign
R0580:Slc7a5 UTSW 8 121885116 missense probably benign 0.21
R0965:Slc7a5 UTSW 8 121907101 missense probably benign 0.01
R1274:Slc7a5 UTSW 8 121883714 missense probably benign 0.44
R2135:Slc7a5 UTSW 8 121883705 missense probably null 0.96
R4163:Slc7a5 UTSW 8 121888400 missense probably benign 0.00
R4506:Slc7a5 UTSW 8 121887495 critical splice donor site probably null
R4910:Slc7a5 UTSW 8 121885122 missense probably damaging 0.96
R5449:Slc7a5 UTSW 8 121886348 missense probably damaging 1.00
R5719:Slc7a5 UTSW 8 121883642 missense probably benign 0.00
R5744:Slc7a5 UTSW 8 121888382 missense probably benign 0.00
R7473:Slc7a5 UTSW 8 121888423 missense probably benign
R7499:Slc7a5 UTSW 8 121883722 missense probably damaging 1.00
R7663:Slc7a5 UTSW 8 121887535 nonsense probably null
R7680:Slc7a5 UTSW 8 121907267 missense probably damaging 1.00
R7682:Slc7a5 UTSW 8 121907140 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAGCCAACTCAATGTCTG -3'
(R):5'- CCAGAGAACCAGCTAGCTTTATC -3'

Sequencing Primer
(F):5'- CTCAATGTCTGAGGCGAGG -3'
(R):5'- GTCTCAGAAAGTCAGAGCCC -3'
Posted On2016-07-06