Incidental Mutation 'R5243:Sdk2'
ID 401002
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 5330435L01Rik, 4632412F08Rik
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R5243 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 113776374-114067046 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113825086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1549 (L1549P)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
AlphaFold Q6V4S5
Predicted Effect possibly damaging
Transcript: ENSMUST00000041627
AA Change: L1549P

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: L1549P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125879
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
Curtailed UTSW 11 113851800 missense probably damaging 1.00
Trimmed UTSW 11 113856696 nonsense probably null
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
BB008:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113859938 missense probably benign 0.18
R8052:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113827089 missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113851713 missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113872857 missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113838716 missense probably benign
R8715:Sdk2 UTSW 11 113780902 missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113873152 nonsense probably null
R9136:Sdk2 UTSW 11 113806377 missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113823400 missense probably benign 0.18
R9300:Sdk2 UTSW 11 113825030 missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113834931 missense probably benign 0.00
R9450:Sdk2 UTSW 11 113806279 missense probably benign
R9462:Sdk2 UTSW 11 113869918 missense possibly damaging 0.56
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113839322 missense probably benign 0.41
Z1176:Sdk2 UTSW 11 113851836 missense probably damaging 0.97
Z1177:Sdk2 UTSW 11 113838659 missense probably damaging 0.99
Z1177:Sdk2 UTSW 11 113839320 missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113859956 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGGTTAGCAGACTCAAGG -3'
(R):5'- TTGCATGGTGATCCCTGTCC -3'

Sequencing Primer
(F):5'- TTAGCAGACTCAAGGAGACTGG -3'
(R):5'- TTTCCTGGTTGGGACCCAGC -3'
Posted On 2016-07-06