Incidental Mutation 'R5243:Wnk2'
ID401008
Institutional Source Beutler Lab
Gene Symbol Wnk2
Ensembl Gene ENSMUSG00000037989
Gene NameWNK lysine deficient protein kinase 2
SynonymsESTM15, X83337, 1810073P09Rik
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49036303-49148014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49072578 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1043 (N1043I)
Ref Sequence ENSEMBL: ENSMUSP00000105724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035538] [ENSMUST00000049265] [ENSMUST00000091623] [ENSMUST00000110096] [ENSMUST00000110097] [ENSMUST00000159559] [ENSMUST00000160087] [ENSMUST00000162403] [ENSMUST00000162581]
Predicted Effect probably benign
Transcript: ENSMUST00000035538
AA Change: N1043I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000047231
Gene: ENSMUSG00000037989
AA Change: N1043I

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049265
AA Change: N1043I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049327
Gene: ENSMUSG00000037989
AA Change: N1043I

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
S_TKc 195 453 3.3e-19 SMART
Pfam:OSR1_C 474 511 5.6e-19 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 9.51e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1703 2.12e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2023 2.12e-5 PROSPERO
low complexity region 2069 2089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091623
AA Change: N1043I

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089212
Gene: ENSMUSG00000037989
AA Change: N1043I

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 1.6e-41 PFAM
Pfam:Pkinase 195 453 1e-54 PFAM
Pfam:OSR1_C 474 511 4e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.52e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 7.41e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 7.41e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
low complexity region 2191 2202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110096
SMART Domains Protein: ENSMUSP00000105723
Gene: ENSMUSG00000037989

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.6e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 1015 1038 N/A INTRINSIC
internal_repeat_1 1064 1087 2.89e-5 PROSPERO
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1219 1255 N/A INTRINSIC
low complexity region 1331 1343 N/A INTRINSIC
low complexity region 1351 1359 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1489 1498 N/A INTRINSIC
low complexity region 1721 1732 N/A INTRINSIC
coiled coil region 1737 1768 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110097
AA Change: N1043I

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105724
Gene: ENSMUSG00000037989
AA Change: N1043I

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.16e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 5.74e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 5.74e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159559
AA Change: N1031I

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123915
Gene: ENSMUSG00000037989
AA Change: N1031I

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 971 1002 N/A INTRINSIC
low complexity region 1009 1036 N/A INTRINSIC
low complexity region 1101 1124 N/A INTRINSIC
internal_repeat_1 1150 1173 7.19e-6 PROSPERO
low complexity region 1263 1280 N/A INTRINSIC
low complexity region 1305 1341 N/A INTRINSIC
low complexity region 1417 1429 N/A INTRINSIC
low complexity region 1437 1445 N/A INTRINSIC
low complexity region 1452 1477 N/A INTRINSIC
low complexity region 1575 1585 N/A INTRINSIC
internal_repeat_2 1599 1701 3.66e-5 PROSPERO
low complexity region 1808 1819 N/A INTRINSIC
coiled coil region 1824 1855 N/A INTRINSIC
internal_repeat_2 1911 2015 3.66e-5 PROSPERO
low complexity region 2105 2125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159633
Predicted Effect probably benign
Transcript: ENSMUST00000160087
SMART Domains Protein: ENSMUSP00000124614
Gene: ENSMUSG00000037989

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
low complexity region 255 278 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
low complexity region 459 495 N/A INTRINSIC
low complexity region 571 583 N/A INTRINSIC
low complexity region 591 599 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 729 738 N/A INTRINSIC
low complexity region 961 972 N/A INTRINSIC
coiled coil region 977 1008 N/A INTRINSIC
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162403
SMART Domains Protein: ENSMUSP00000125539
Gene: ENSMUSG00000037989

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.3e-42 PFAM
Pfam:Pkinase 195 453 1.6e-56 PFAM
Pfam:OSR1_C 474 511 5.3e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 1003 1026 N/A INTRINSIC
internal_repeat_1 1052 1075 1.05e-5 PROSPERO
low complexity region 1165 1182 N/A INTRINSIC
low complexity region 1207 1243 N/A INTRINSIC
low complexity region 1319 1331 N/A INTRINSIC
low complexity region 1339 1347 N/A INTRINSIC
low complexity region 1354 1379 N/A INTRINSIC
low complexity region 1477 1487 N/A INTRINSIC
internal_repeat_2 1501 1593 2.32e-5 PROSPERO
low complexity region 1710 1721 N/A INTRINSIC
coiled coil region 1726 1757 N/A INTRINSIC
internal_repeat_2 1813 1913 2.32e-5 PROSPERO
low complexity region 1959 1979 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162581
AA Change: N1043I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125448
Gene: ENSMUSG00000037989
AA Change: N1043I

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Meta Mutation Damage Score 0.1371 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in Wnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Wnk2 APN 13 49068192 missense possibly damaging 0.89
IGL01575:Wnk2 APN 13 49146676 missense probably damaging 1.00
IGL01601:Wnk2 APN 13 49076562 missense probably damaging 1.00
IGL01775:Wnk2 APN 13 49071110 missense probably damaging 1.00
IGL02013:Wnk2 APN 13 49082034 missense possibly damaging 0.46
IGL02016:Wnk2 APN 13 49056905 missense probably damaging 1.00
IGL02167:Wnk2 APN 13 49071125 critical splice acceptor site probably null
IGL02174:Wnk2 APN 13 49057167 missense probably damaging 1.00
IGL02210:Wnk2 APN 13 49090869 missense probably damaging 0.98
IGL02228:Wnk2 APN 13 49056940 missense probably damaging 1.00
IGL02282:Wnk2 APN 13 49068125 missense probably damaging 1.00
IGL02319:Wnk2 APN 13 49061438 missense possibly damaging 0.73
IGL02394:Wnk2 APN 13 49081899 splice site probably null
IGL02624:Wnk2 APN 13 49102802 missense probably damaging 1.00
IGL02743:Wnk2 APN 13 49095444 missense probably damaging 1.00
IGL03012:Wnk2 APN 13 49044389 missense probably damaging 0.99
IGL03166:Wnk2 APN 13 49071044 nonsense probably null
R0034:Wnk2 UTSW 13 49068080 missense possibly damaging 0.64
R0385:Wnk2 UTSW 13 49068128 missense probably damaging 1.00
R0423:Wnk2 UTSW 13 49095418 missense possibly damaging 0.91
R0504:Wnk2 UTSW 13 49085394 missense possibly damaging 0.92
R0504:Wnk2 UTSW 13 49085396 missense probably damaging 1.00
R0653:Wnk2 UTSW 13 49057016 missense possibly damaging 0.85
R1135:Wnk2 UTSW 13 49076558 missense probably damaging 1.00
R1445:Wnk2 UTSW 13 49071110 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1480:Wnk2 UTSW 13 49057232 missense probably damaging 1.00
R1605:Wnk2 UTSW 13 49060894 missense probably damaging 1.00
R1719:Wnk2 UTSW 13 49060726 missense possibly damaging 0.76
R1891:Wnk2 UTSW 13 49052724 nonsense probably null
R1966:Wnk2 UTSW 13 49039011 missense probably damaging 0.96
R2001:Wnk2 UTSW 13 49078682 missense possibly damaging 0.61
R2310:Wnk2 UTSW 13 49050577 missense probably damaging 0.97
R2356:Wnk2 UTSW 13 49039168 nonsense probably null
R2406:Wnk2 UTSW 13 49061488 missense possibly damaging 0.86
R2519:Wnk2 UTSW 13 49071029 missense probably damaging 0.99
R3962:Wnk2 UTSW 13 49070977 missense probably damaging 1.00
R4160:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4161:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4226:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4227:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4234:Wnk2 UTSW 13 49061128 missense probably benign 0.33
R4304:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4308:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4584:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4655:Wnk2 UTSW 13 49056883 missense probably damaging 1.00
R4715:Wnk2 UTSW 13 49147232 start codon destroyed unknown
R4887:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4888:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4945:Wnk2 UTSW 13 49057246 missense probably damaging 1.00
R5182:Wnk2 UTSW 13 49061161 missense possibly damaging 0.92
R5370:Wnk2 UTSW 13 49102961 missense probably damaging 1.00
R5771:Wnk2 UTSW 13 49102800 missense probably damaging 1.00
R5877:Wnk2 UTSW 13 49067306 missense probably damaging 0.98
R5900:Wnk2 UTSW 13 49102832 missense probably damaging 1.00
R5905:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R5912:Wnk2 UTSW 13 49060774 missense probably damaging 1.00
R5915:Wnk2 UTSW 13 49078085 missense probably damaging 0.99
R6028:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R6074:Wnk2 UTSW 13 49051399 missense probably damaging 1.00
R6171:Wnk2 UTSW 13 49060832 missense probably damaging 1.00
R6368:Wnk2 UTSW 13 49061338 missense probably damaging 0.99
R6467:Wnk2 UTSW 13 49146605 missense probably damaging 1.00
R6501:Wnk2 UTSW 13 49146683 missense probably damaging 1.00
R6849:Wnk2 UTSW 13 49067358 missense probably damaging 1.00
R6898:Wnk2 UTSW 13 49071081 missense probably damaging 1.00
R6949:Wnk2 UTSW 13 49101140 missense probably damaging 1.00
R7011:Wnk2 UTSW 13 49071091 missense probably damaging 0.99
R7097:Wnk2 UTSW 13 49102838 missense possibly damaging 0.86
R7121:Wnk2 UTSW 13 49147177 missense probably benign 0.26
R7123:Wnk2 UTSW 13 49081986 missense possibly damaging 0.90
R7423:Wnk2 UTSW 13 49038132 missense probably benign 0.07
R7502:Wnk2 UTSW 13 49147244 splice site probably null
R7529:Wnk2 UTSW 13 49100981 missense possibly damaging 0.50
X0025:Wnk2 UTSW 13 49060942 missense probably damaging 0.99
X0063:Wnk2 UTSW 13 49038977 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGTGGGCCAGTGCAGAG -3'
(R):5'- TTCATACACCGCGGACGTTG -3'

Sequencing Primer
(F):5'- CAGCTTGCAGTATCTGTTCCAGAG -3'
(R):5'- GACGTTGCTGCTCCAGTC -3'
Posted On2016-07-06