Incidental Mutation 'R5243:E4f1'
ID401016
Institutional Source Beutler Lab
Gene Symbol E4f1
Ensembl Gene ENSMUSG00000024137
Gene NameE4F transcription factor 1
Synonyms
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24443778-24470313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24447318 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 198 (C198S)
Ref Sequence ENSEMBL: ENSMUSP00000154444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056032] [ENSMUST00000088506] [ENSMUST00000119932] [ENSMUST00000148820] [ENSMUST00000154675] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably damaging
Transcript: ENSMUST00000056032
AA Change: C198S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137
AA Change: C198S

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088506
SMART Domains Protein: ENSMUSP00000085862
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119932
SMART Domains Protein: ENSMUSP00000113508
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148820
SMART Domains Protein: ENSMUSP00000119453
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
Blast:DNaseIc 5 60 2e-33 BLAST
PDB:4AWN|A 22 60 5e-8 PDB
SCOP:d2dnja_ 22 60 3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154675
SMART Domains Protein: ENSMUSP00000116743
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 1 180 4.58e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226654
AA Change: C39S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226754
AA Change: C198S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226941
AA Change: C198S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227293
Predicted Effect unknown
Transcript: ENSMUST00000228882
AA Change: C120S
Meta Mutation Damage Score 0.9722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: This gene encodes a member of the GLI-Kruppel zinc finger family. The encoded protein is likely to be multi-functional, with both adenovirus E1A-regulated transcription factor and ubiquitin E3 ligase activities, including roles in cell cycle regulation and the ubiquitination of p53. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display early embryonic lethality with mitotic progression failure and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in E4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:E4f1 APN 17 24444234 missense probably damaging 0.99
IGL02306:E4f1 APN 17 24446929 missense probably damaging 1.00
IGL03219:E4f1 APN 17 24445445 critical splice donor site probably null
FR4342:E4f1 UTSW 17 24455197 unclassified probably benign
FR4737:E4f1 UTSW 17 24455192 unclassified probably benign
R0084:E4f1 UTSW 17 24444082 missense possibly damaging 0.79
R0179:E4f1 UTSW 17 24451437 missense possibly damaging 0.57
R1171:E4f1 UTSW 17 24451549 missense probably damaging 1.00
R1773:E4f1 UTSW 17 24446584 missense probably damaging 1.00
R4531:E4f1 UTSW 17 24445987 missense possibly damaging 0.56
R5430:E4f1 UTSW 17 24444970 missense probably damaging 1.00
R5543:E4f1 UTSW 17 24447362 missense possibly damaging 0.49
R5598:E4f1 UTSW 17 24447129 missense probably damaging 1.00
R5604:E4f1 UTSW 17 24444144 missense probably damaging 1.00
R5858:E4f1 UTSW 17 24445328 missense probably damaging 1.00
R6240:E4f1 UTSW 17 24444582 missense possibly damaging 0.54
R6703:E4f1 UTSW 17 24447131 missense probably damaging 1.00
R7108:E4f1 UTSW 17 24444578 missense probably damaging 0.96
R7122:E4f1 UTSW 17 24444834 nonsense probably null
R7240:E4f1 UTSW 17 24444325 missense probably damaging 1.00
R7604:E4f1 UTSW 17 24455233 missense unknown
R7648:E4f1 UTSW 17 24445448 missense probably benign 0.02
RF002:E4f1 UTSW 17 24455186 unclassified probably benign
RF011:E4f1 UTSW 17 24455186 unclassified probably benign
RF020:E4f1 UTSW 17 24455195 unclassified probably benign
RF023:E4f1 UTSW 17 24455183 unclassified probably benign
RF028:E4f1 UTSW 17 24455190 unclassified probably benign
RF033:E4f1 UTSW 17 24455183 unclassified probably benign
RF035:E4f1 UTSW 17 24455190 unclassified probably benign
RF035:E4f1 UTSW 17 24455195 unclassified probably benign
Z1176:E4f1 UTSW 17 24446145 missense not run
Predicted Primers PCR Primer
(F):5'- CTTCACATACCAGTGTGCCG -3'
(R):5'- GGGCACATCAAAGAGGTCATTG -3'

Sequencing Primer
(F):5'- AGCCCTTGGTCCGAAAAG -3'
(R):5'- CATCAAAGAGGTCATTGTGGCTGC -3'
Posted On2016-07-06