Incidental Mutation 'R5243:Olfr1505'
ID401022
Institutional Source Beutler Lab
Gene Symbol Olfr1505
Ensembl Gene ENSMUSG00000062314
Gene Nameolfactory receptor 1505
SynonymsMOR211-4P, GA_x6K02T2RE5P-4250267-4251217, MOR211-10_i
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13913530-13921866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13919661 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 214 (I214V)
Ref Sequence ENSEMBL: ENSMUSP00000148945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081520] [ENSMUST00000216623] [ENSMUST00000216835]
Predicted Effect probably damaging
Transcript: ENSMUST00000081520
AA Change: I214V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080235
Gene: ENSMUSG00000062314
AA Change: I214V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-43 PFAM
Pfam:7tm_1 41 290 2.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216623
AA Change: I214V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216835
AA Change: I214V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.4137 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in Olfr1505
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr1505 APN 19 13919528 nonsense probably null
IGL03388:Olfr1505 APN 19 13919620 missense probably damaging 0.99
R0143:Olfr1505 UTSW 19 13919250 missense probably damaging 1.00
R0326:Olfr1505 UTSW 19 13919509 missense probably benign 0.13
R0602:Olfr1505 UTSW 19 13919781 missense probably benign 0.13
R0624:Olfr1505 UTSW 19 13919444 missense probably damaging 0.99
R0947:Olfr1505 UTSW 19 13919171 missense probably benign 0.00
R1472:Olfr1505 UTSW 19 13919844 missense probably damaging 1.00
R1691:Olfr1505 UTSW 19 13919419 missense probably benign 0.00
R2991:Olfr1505 UTSW 19 13919311 missense probably damaging 1.00
R4296:Olfr1505 UTSW 19 13919353 missense probably damaging 1.00
R4688:Olfr1505 UTSW 19 13919241 missense probably benign 0.01
R4814:Olfr1505 UTSW 19 13919453 missense possibly damaging 0.50
R4823:Olfr1505 UTSW 19 13919658 missense probably benign 0.02
R5038:Olfr1505 UTSW 19 13919458 missense possibly damaging 0.58
R5323:Olfr1505 UTSW 19 13919616 missense possibly damaging 0.95
R5542:Olfr1505 UTSW 19 13919047 missense probably benign 0.04
R5918:Olfr1505 UTSW 19 13919775 missense probably damaging 1.00
R6011:Olfr1505 UTSW 19 13919157 missense probably benign 0.00
R6159:Olfr1505 UTSW 19 13919740 missense probably damaging 1.00
R7535:Olfr1505 UTSW 19 13919085 missense probably benign
R8262:Olfr1505 UTSW 19 13919862 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATTCTGCGTACCACATGCACC -3'
(R):5'- TAGACAAGTGGGTTCAGCATGG -3'

Sequencing Primer
(F):5'- GCGTACCACATGCACCTTCTC -3'
(R):5'- TTCAGCATGGGAATGACCAC -3'
Posted On2016-07-06