Incidental Mutation 'R5244:Olfr1285'
ID401033
Institutional Source Beutler Lab
Gene Symbol Olfr1285
Ensembl Gene ENSMUSG00000062280
Gene Nameolfactory receptor 1285
SynonymsMOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837
MMRRC Submission 042815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5244 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111408376-111409331 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 111408554 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000184954]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184954
AA Change: I60N
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: I60N

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220153
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,411,798 G45W probably damaging Het
Abca13 C T 11: 9,275,081 T520I probably benign Het
Adamtsl3 C T 7: 82,598,069 P485L probably benign Het
Bbof1 A C 12: 84,430,073 E492A possibly damaging Het
Capn11 T C 17: 45,633,892 E483G probably damaging Het
Cbs C T 17: 31,617,160 G438D probably damaging Het
Chil6 A G 3: 106,389,974 Y284H probably damaging Het
Cops4 C A 5: 100,533,375 Q131K probably benign Het
Cul4a T C 8: 13,146,566 I740T probably damaging Het
Cyfip1 C T 7: 55,925,199 T1066I probably damaging Het
Dnah7b T C 1: 46,233,858 L2382P probably damaging Het
Ehd3 A T 17: 73,830,000 H388L probably benign Het
Fam13a G T 6: 58,953,474 Y484* probably null Het
Gm5117 A G 8: 31,738,277 noncoding transcript Het
Gulp1 G A 1: 44,788,453 D260N probably damaging Het
Hhipl1 T A 12: 108,312,134 N240K probably damaging Het
Hydin A T 8: 110,532,819 E2474D possibly damaging Het
Ifi207 C T 1: 173,729,937 V412I probably benign Het
Ighv9-4 T C 12: 114,300,251 I21V probably benign Het
Kcnh1 A T 1: 192,224,876 T79S probably benign Het
Kpna6 A G 4: 129,655,428 probably null Het
Lnpk C T 2: 74,531,888 G262D probably damaging Het
Lsm7 T C 10: 80,853,073 E66G probably benign Het
Mbd3l1 T A 9: 18,484,637 C19* probably null Het
Mfsd6l T A 11: 68,557,175 L284Q possibly damaging Het
Naip5 C T 13: 100,245,662 V180I probably benign Het
Olfr1037 C G 2: 86,084,956 A274P probably damaging Het
Olfr213 T A 6: 116,541,226 Y258N probably damaging Het
Olfr44 T G 9: 39,484,512 H247P probably damaging Het
Olfr531 A T 7: 140,400,138 C303S probably benign Het
Olfr694 T A 7: 106,689,189 I181F probably benign Het
Olfr837 A T 9: 19,137,851 N286I probably damaging Het
Pck1 T A 2: 173,154,863 I190N possibly damaging Het
Pfkfb3 T A 2: 11,484,849 I209F probably damaging Het
Phc1 A G 6: 122,321,979 S677P probably damaging Het
Pirb G A 7: 3,716,063 A609V probably benign Het
Plag1 A T 4: 3,903,887 S435T probably benign Het
Plscr2 C G 9: 92,291,049 L215V probably benign Het
Pnmal1 A G 7: 16,961,323 S368G probably damaging Het
Polr2b A G 5: 77,343,000 probably benign Het
Pthlh T C 6: 147,257,153 Y103C probably damaging Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rprd2 T A 3: 95,790,182 I85L possibly damaging Het
Slc27a2 T C 2: 126,578,855 V422A probably benign Het
Slc29a1 T C 17: 45,588,413 probably benign Het
Slc36a4 A T 9: 15,734,278 I334F probably benign Het
Slc4a10 T A 2: 62,288,725 S761R probably damaging Het
Spa17 T A 9: 37,611,989 M1L probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk19 A G 17: 34,832,070 L72P probably damaging Het
Trhde T C 10: 114,801,081 M74V probably benign Het
Trim37 C T 11: 87,218,257 H937Y probably benign Het
Ttc7b A G 12: 100,348,010 L46P probably damaging Het
Ttll4 T C 1: 74,696,448 V1005A probably benign Het
Ugt2b36 T C 5: 87,091,906 T207A probably damaging Het
Unc13c C T 9: 73,525,951 probably null Het
Vmn1r221 T C 13: 23,217,638 noncoding transcript Het
Vmn2r101 T C 17: 19,611,526 S595P probably damaging Het
Wnt10a T C 1: 74,803,295 L310P probably damaging Het
Yif1b G A 7: 29,244,441 A115T probably damaging Het
Zfp219 C A 14: 52,008,542 R331L possibly damaging Het
Other mutations in Olfr1285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1285 APN 2 111409219 missense probably damaging 1.00
IGL01819:Olfr1285 APN 2 111408733 missense probably damaging 0.99
IGL02109:Olfr1285 APN 2 111408493 exon noncoding transcript
IGL02407:Olfr1285 APN 2 111408578 exon noncoding transcript
R0054:Olfr1285 UTSW 2 111408795 missense probably benign 0.00
R1665:Olfr1285 UTSW 2 111408753 missense probably damaging 1.00
R2339:Olfr1285 UTSW 2 111409189 missense probably benign 0.36
R3876:Olfr1285 UTSW 2 111408622 missense possibly damaging 0.57
R4260:Olfr1285 UTSW 2 111408505 exon noncoding transcript
R4439:Olfr1285 UTSW 2 111409308 exon noncoding transcript
R4762:Olfr1285 UTSW 2 111408880 exon noncoding transcript
R4821:Olfr1285 UTSW 2 111409225 exon noncoding transcript
R5120:Olfr1285 UTSW 2 111409240 exon noncoding transcript
R5215:Olfr1285 UTSW 2 111409286 exon noncoding transcript
R5667:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5671:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5687:Olfr1285 UTSW 2 111408688 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGGAGCCTTCTGAGCTAAGAC -3'
(R):5'- GGCCATTGTTACAAGAAGCACC -3'

Sequencing Primer
(F):5'- AGCTATTGTTTCTCTTGCAGAAC -3'
(R):5'- ATTGTTACAAGAAGCACCATCTC -3'
Posted On2016-07-06