Incidental Mutation 'R5244:Pirb'
ID401048
Institutional Source Beutler Lab
Gene Symbol Pirb
Ensembl Gene ENSMUSG00000058818
Gene Namepaired Ig-like receptor B
SynonymsLilrb3, Gp91
MMRRC Submission 042815-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5244 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3711409-3720391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3716063 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 609 (A609V)
Ref Sequence ENSEMBL: ENSMUSP00000077546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078451]
Predicted Effect probably benign
Transcript: ENSMUST00000078451
AA Change: A609V

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: A609V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 118 1.8e-3 SMART
IG 129 315 1.2e-4 SMART
IG_like 237 302 6.2e-4 SMART
IG_like 328 415 3.4e-2 SMART
IG_like 435 502 1e-2 SMART
IG 529 618 3.6e-5 SMART
low complexity region 624 637 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155131
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,411,798 G45W probably damaging Het
Abca13 C T 11: 9,275,081 T520I probably benign Het
Adamtsl3 C T 7: 82,598,069 P485L probably benign Het
Bbof1 A C 12: 84,430,073 E492A possibly damaging Het
Capn11 T C 17: 45,633,892 E483G probably damaging Het
Cbs C T 17: 31,617,160 G438D probably damaging Het
Chil6 A G 3: 106,389,974 Y284H probably damaging Het
Cops4 C A 5: 100,533,375 Q131K probably benign Het
Cul4a T C 8: 13,146,566 I740T probably damaging Het
Cyfip1 C T 7: 55,925,199 T1066I probably damaging Het
Dnah7b T C 1: 46,233,858 L2382P probably damaging Het
Ehd3 A T 17: 73,830,000 H388L probably benign Het
Fam13a G T 6: 58,953,474 Y484* probably null Het
Gm5117 A G 8: 31,738,277 noncoding transcript Het
Gulp1 G A 1: 44,788,453 D260N probably damaging Het
Hhipl1 T A 12: 108,312,134 N240K probably damaging Het
Hydin A T 8: 110,532,819 E2474D possibly damaging Het
Ifi207 C T 1: 173,729,937 V412I probably benign Het
Ighv9-4 T C 12: 114,300,251 I21V probably benign Het
Kcnh1 A T 1: 192,224,876 T79S probably benign Het
Kpna6 A G 4: 129,655,428 probably null Het
Lnpk C T 2: 74,531,888 G262D probably damaging Het
Lsm7 T C 10: 80,853,073 E66G probably benign Het
Mbd3l1 T A 9: 18,484,637 C19* probably null Het
Mfsd6l T A 11: 68,557,175 L284Q possibly damaging Het
Naip5 C T 13: 100,245,662 V180I probably benign Het
Olfr1037 C G 2: 86,084,956 A274P probably damaging Het
Olfr1285 T A 2: 111,408,554 noncoding transcript Het
Olfr213 T A 6: 116,541,226 Y258N probably damaging Het
Olfr44 T G 9: 39,484,512 H247P probably damaging Het
Olfr531 A T 7: 140,400,138 C303S probably benign Het
Olfr694 T A 7: 106,689,189 I181F probably benign Het
Olfr837 A T 9: 19,137,851 N286I probably damaging Het
Pck1 T A 2: 173,154,863 I190N possibly damaging Het
Pfkfb3 T A 2: 11,484,849 I209F probably damaging Het
Phc1 A G 6: 122,321,979 S677P probably damaging Het
Plag1 A T 4: 3,903,887 S435T probably benign Het
Plscr2 C G 9: 92,291,049 L215V probably benign Het
Pnmal1 A G 7: 16,961,323 S368G probably damaging Het
Polr2b A G 5: 77,343,000 probably benign Het
Pthlh T C 6: 147,257,153 Y103C probably damaging Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rprd2 T A 3: 95,790,182 I85L possibly damaging Het
Slc27a2 T C 2: 126,578,855 V422A probably benign Het
Slc29a1 T C 17: 45,588,413 probably benign Het
Slc36a4 A T 9: 15,734,278 I334F probably benign Het
Slc4a10 T A 2: 62,288,725 S761R probably damaging Het
Spa17 T A 9: 37,611,989 M1L probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk19 A G 17: 34,832,070 L72P probably damaging Het
Trhde T C 10: 114,801,081 M74V probably benign Het
Trim37 C T 11: 87,218,257 H937Y probably benign Het
Ttc7b A G 12: 100,348,010 L46P probably damaging Het
Ttll4 T C 1: 74,696,448 V1005A probably benign Het
Ugt2b36 T C 5: 87,091,906 T207A probably damaging Het
Unc13c C T 9: 73,525,951 probably null Het
Vmn1r221 T C 13: 23,217,638 noncoding transcript Het
Vmn2r101 T C 17: 19,611,526 S595P probably damaging Het
Wnt10a T C 1: 74,803,295 L310P probably damaging Het
Yif1b G A 7: 29,244,441 A115T probably damaging Het
Zfp219 C A 14: 52,008,542 R331L possibly damaging Het
Other mutations in Pirb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pirb APN 7 3717406 missense probably damaging 0.99
IGL01744:Pirb APN 7 3717176 nonsense probably null
IGL01755:Pirb APN 7 3717170 missense probably benign 0.16
IGL02580:Pirb APN 7 3714206 splice site probably null
IGL02941:Pirb APN 7 3717378 missense probably damaging 1.00
R0394:Pirb UTSW 7 3719248 missense probably benign 0.08
R0680:Pirb UTSW 7 3717361 missense possibly damaging 0.94
R0787:Pirb UTSW 7 3717638 missense probably benign
R0790:Pirb UTSW 7 3717638 missense probably benign
R0832:Pirb UTSW 7 3717638 missense probably benign
R1124:Pirb UTSW 7 3719732 missense probably benign 0.02
R1178:Pirb UTSW 7 3717638 missense probably benign
R1180:Pirb UTSW 7 3717638 missense probably benign
R1181:Pirb UTSW 7 3717638 missense probably benign
R1281:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1343:Pirb UTSW 7 3717638 missense probably benign
R1579:Pirb UTSW 7 3717638 missense probably benign
R1699:Pirb UTSW 7 3717638 missense probably benign
R1768:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1909:Pirb UTSW 7 3714588 missense probably benign 0.33
R1965:Pirb UTSW 7 3717638 missense probably benign
R1966:Pirb UTSW 7 3717638 missense probably benign
R2004:Pirb UTSW 7 3717638 missense probably benign
R2305:Pirb UTSW 7 3712991 missense probably benign 0.00
R2931:Pirb UTSW 7 3717206 missense probably benign 0.08
R3858:Pirb UTSW 7 3717663 missense possibly damaging 0.54
R3928:Pirb UTSW 7 3717638 missense probably benign
R3938:Pirb UTSW 7 3717638 missense probably benign
R4119:Pirb UTSW 7 3717575 missense probably damaging 1.00
R4174:Pirb UTSW 7 3716032 critical splice donor site probably null
R4248:Pirb UTSW 7 3719298 missense probably damaging 1.00
R4827:Pirb UTSW 7 3717603 missense probably benign
R4828:Pirb UTSW 7 3717603 missense probably benign
R4829:Pirb UTSW 7 3717603 missense probably benign
R4830:Pirb UTSW 7 3717603 missense probably benign
R4870:Pirb UTSW 7 3712662 missense probably benign 0.00
R4909:Pirb UTSW 7 3719362 nonsense probably null
R5146:Pirb UTSW 7 3712621 utr 3 prime probably benign
R5323:Pirb UTSW 7 3716599 missense possibly damaging 0.85
R5921:Pirb UTSW 7 3716694 nonsense probably null
R6316:Pirb UTSW 7 3717823 missense probably damaging 1.00
R6502:Pirb UTSW 7 3717393 missense probably benign 0.00
R6811:Pirb UTSW 7 3719642 missense possibly damaging 0.91
R7216:Pirb UTSW 7 3716274 missense probably benign 0.00
R7275:Pirb UTSW 7 3716178 missense probably benign 0.00
R7327:Pirb UTSW 7 3717188 nonsense probably null
R7582:Pirb UTSW 7 3713818 critical splice donor site probably null
R7717:Pirb UTSW 7 3717783 missense not run
R7717:Pirb UTSW 7 3717801 missense not run
R7807:Pirb UTSW 7 3719865 missense possibly damaging 0.55
R7844:Pirb UTSW 7 3719411 nonsense probably null
R7927:Pirb UTSW 7 3719411 nonsense probably null
R8206:Pirb UTSW 7 3712906 critical splice donor site probably null
X0025:Pirb UTSW 7 3717268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACTGCTAGCATTAATTCCTCTG -3'
(R):5'- ACAGTGCACTCAGGAGAGAC -3'

Sequencing Primer
(F):5'- TAATTCCTCTGCCAGGGAAACTG -3'
(R):5'- TCAATGGACTCTGTGGATACTTTC -3'
Posted On2016-07-06