Mutagenetix > Incidental Mutations

Incidental Mutation 'R5244:Adamtsl3'

401054

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

MMRRC Submission

042815-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5244 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 82598069 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 485 (P485L)

Ref Sequence

ENSEMBL: ENSMUSP00000133337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]

Predicted Effect

probably benign
Transcript: ENSMUST00000173287
AA Change: P1411L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: P1411L

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173828
AA Change: P485L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: P485L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

97% (63/65)

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	G	T	9: 53,411,798	G45W	probably damaging	Het
Abca13	C	T	11: 9,275,081	T520I	probably benign	Het
Bbof1	A	C	12: 84,430,073	E492A	possibly damaging	Het
Capn11	T	C	17: 45,633,892	E483G	probably damaging	Het
Cbs	C	T	17: 31,617,160	G438D	probably damaging	Het
Chil6	A	G	3: 106,389,974	Y284H	probably damaging	Het
Cops4	C	A	5: 100,533,375	Q131K	probably benign	Het
Cul4a	T	C	8: 13,146,566	I740T	probably damaging	Het
Cyfip1	C	T	7: 55,925,199	T1066I	probably damaging	Het
Dnah7b	T	C	1: 46,233,858	L2382P	probably damaging	Het
Ehd3	A	T	17: 73,830,000	H388L	probably benign	Het
Fam13a	G	T	6: 58,953,474	Y484*	probably null	Het
Gm5117	A	G	8: 31,738,277		noncoding transcript	Het
Gulp1	G	A	1: 44,788,453	D260N	probably damaging	Het
Hhipl1	T	A	12: 108,312,134	N240K	probably damaging	Het
Hydin	A	T	8: 110,532,819	E2474D	possibly damaging	Het
Ifi207	C	T	1: 173,729,937	V412I	probably benign	Het
Ighv9-4	T	C	12: 114,300,251	I21V	probably benign	Het
Kcnh1	A	T	1: 192,224,876	T79S	probably benign	Het
Kpna6	A	G	4: 129,655,428		probably null	Het
Lnpk	C	T	2: 74,531,888	G262D	probably damaging	Het
Lsm7	T	C	10: 80,853,073	E66G	probably benign	Het
Mbd3l1	T	A	9: 18,484,637	C19*	probably null	Het
Mfsd6l	T	A	11: 68,557,175	L284Q	possibly damaging	Het
Naip5	C	T	13: 100,245,662	V180I	probably benign	Het
Olfr1037	C	G	2: 86,084,956	A274P	probably damaging	Het
Olfr1285	T	A	2: 111,408,554		noncoding transcript	Het
Olfr213	T	A	6: 116,541,226	Y258N	probably damaging	Het
Olfr44	T	G	9: 39,484,512	H247P	probably damaging	Het
Olfr531	A	T	7: 140,400,138	C303S	probably benign	Het
Olfr694	T	A	7: 106,689,189	I181F	probably benign	Het
Olfr837	A	T	9: 19,137,851	N286I	probably damaging	Het
Pck1	T	A	2: 173,154,863	I190N	possibly damaging	Het
Pfkfb3	T	A	2: 11,484,849	I209F	probably damaging	Het
Phc1	A	G	6: 122,321,979	S677P	probably damaging	Het
Pirb	G	A	7: 3,716,063	A609V	probably benign	Het
Plag1	A	T	4: 3,903,887	S435T	probably benign	Het
Plscr2	C	G	9: 92,291,049	L215V	probably benign	Het
Pnmal1	A	G	7: 16,961,323	S368G	probably damaging	Het
Polr2b	A	G	5: 77,343,000		probably benign	Het
Pthlh	T	C	6: 147,257,153	Y103C	probably damaging	Het
Ptprq	A	G	10: 107,586,695	V1612A	possibly damaging	Het
Rprd2	T	A	3: 95,790,182	I85L	possibly damaging	Het
Slc27a2	T	C	2: 126,578,855	V422A	probably benign	Het
Slc29a1	T	C	17: 45,588,413		probably benign	Het
Slc36a4	A	T	9: 15,734,278	I334F	probably benign	Het
Slc4a10	T	A	2: 62,288,725	S761R	probably damaging	Het
Spa17	T	A	9: 37,611,989	M1L	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stk19	A	G	17: 34,832,070	L72P	probably damaging	Het
Trhde	T	C	10: 114,801,081	M74V	probably benign	Het
Trim37	C	T	11: 87,218,257	H937Y	probably benign	Het
Ttc7b	A	G	12: 100,348,010	L46P	probably damaging	Het
Ttll4	T	C	1: 74,696,448	V1005A	probably benign	Het
Ugt2b36	T	C	5: 87,091,906	T207A	probably damaging	Het
Unc13c	C	T	9: 73,525,951		probably null	Het
Vmn1r221	T	C	13: 23,217,638		noncoding transcript	Het
Vmn2r101	T	C	17: 19,611,526	S595P	probably damaging	Het
Wnt10a	T	C	1: 74,803,295	L310P	probably damaging	Het
Yif1b	G	A	7: 29,244,441	A115T	probably damaging	Het
Zfp219	C	A	14: 52,008,542	R331L	possibly damaging	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0295:Adamtsl3	UTSW	7	82548005	critical splice donor site	probably null
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0845:Adamtsl3	UTSW	7	82575996	missense	probably damaging	1.00
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4842:Adamtsl3	UTSW	7	82528861	missense	probably damaging	1.00
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5198:Adamtsl3	UTSW	7	82611798	missense	possibly damaging	0.63
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5682:Adamtsl3	UTSW	7	82606550	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	splice site	probably null
R5946:Adamtsl3	UTSW	7	82576057	missense	probably damaging	0.98
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	splice site	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R8109:Adamtsl3	UTSW	7	82602279	missense	possibly damaging	0.94
R8125:Adamtsl3	UTSW	7	82450333	splice site	probably null
R8211:Adamtsl3	UTSW	7	82523163	missense	probably damaging	1.00
R8348:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8360:Adamtsl3	UTSW	7	82547979	missense	probably damaging	1.00
R8448:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTCCCCAGACCTGTGTAAG -3'
(R):5'- ACTACCAAAGACTGAGGGCC -3'

Sequencing Primer
(F):5'- CTGTGTAAGGGCATCCATAAAC -3'
(R):5'- ACCTAAGTGCCCAGGTATAGGTTC -3'

Posted On

2016-07-06