Incidental Mutation 'R5244:Gm5117'
ID401058
Institutional Source Beutler Lab
Gene Symbol Gm5117
Ensembl Gene ENSMUSG00000093862
Gene Namepredicted gene 5117
Synonyms
MMRRC Submission 042815-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R5244 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31737208-31739760 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 31738277 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178878
SMART Domains Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
low complexity region 608 627 N/A INTRINSIC
Pfam:Met_10 666 799 1.5e-9 PFAM
Pfam:UPF0020 672 770 4e-8 PFAM
Pfam:Methyltransf_18 687 815 5e-10 PFAM
Pfam:Methyltransf_31 688 801 1.5e-10 PFAM
Pfam:Methyltransf_26 688 803 1e-8 PFAM
Pfam:Methyltransf_15 688 842 5e-48 PFAM
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,411,798 G45W probably damaging Het
Abca13 C T 11: 9,275,081 T520I probably benign Het
Adamtsl3 C T 7: 82,598,069 P485L probably benign Het
Bbof1 A C 12: 84,430,073 E492A possibly damaging Het
Capn11 T C 17: 45,633,892 E483G probably damaging Het
Cbs C T 17: 31,617,160 G438D probably damaging Het
Chil6 A G 3: 106,389,974 Y284H probably damaging Het
Cops4 C A 5: 100,533,375 Q131K probably benign Het
Cul4a T C 8: 13,146,566 I740T probably damaging Het
Cyfip1 C T 7: 55,925,199 T1066I probably damaging Het
Dnah7b T C 1: 46,233,858 L2382P probably damaging Het
Ehd3 A T 17: 73,830,000 H388L probably benign Het
Fam13a G T 6: 58,953,474 Y484* probably null Het
Gulp1 G A 1: 44,788,453 D260N probably damaging Het
Hhipl1 T A 12: 108,312,134 N240K probably damaging Het
Hydin A T 8: 110,532,819 E2474D possibly damaging Het
Ifi207 C T 1: 173,729,937 V412I probably benign Het
Ighv9-4 T C 12: 114,300,251 I21V probably benign Het
Kcnh1 A T 1: 192,224,876 T79S probably benign Het
Kpna6 A G 4: 129,655,428 probably null Het
Lnpk C T 2: 74,531,888 G262D probably damaging Het
Lsm7 T C 10: 80,853,073 E66G probably benign Het
Mbd3l1 T A 9: 18,484,637 C19* probably null Het
Mfsd6l T A 11: 68,557,175 L284Q possibly damaging Het
Naip5 C T 13: 100,245,662 V180I probably benign Het
Olfr1037 C G 2: 86,084,956 A274P probably damaging Het
Olfr1285 T A 2: 111,408,554 noncoding transcript Het
Olfr213 T A 6: 116,541,226 Y258N probably damaging Het
Olfr44 T G 9: 39,484,512 H247P probably damaging Het
Olfr531 A T 7: 140,400,138 C303S probably benign Het
Olfr694 T A 7: 106,689,189 I181F probably benign Het
Olfr837 A T 9: 19,137,851 N286I probably damaging Het
Pck1 T A 2: 173,154,863 I190N possibly damaging Het
Pfkfb3 T A 2: 11,484,849 I209F probably damaging Het
Phc1 A G 6: 122,321,979 S677P probably damaging Het
Pirb G A 7: 3,716,063 A609V probably benign Het
Plag1 A T 4: 3,903,887 S435T probably benign Het
Plscr2 C G 9: 92,291,049 L215V probably benign Het
Pnmal1 A G 7: 16,961,323 S368G probably damaging Het
Polr2b A G 5: 77,343,000 probably benign Het
Pthlh T C 6: 147,257,153 Y103C probably damaging Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rprd2 T A 3: 95,790,182 I85L possibly damaging Het
Slc27a2 T C 2: 126,578,855 V422A probably benign Het
Slc29a1 T C 17: 45,588,413 probably benign Het
Slc36a4 A T 9: 15,734,278 I334F probably benign Het
Slc4a10 T A 2: 62,288,725 S761R probably damaging Het
Spa17 T A 9: 37,611,989 M1L probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk19 A G 17: 34,832,070 L72P probably damaging Het
Trhde T C 10: 114,801,081 M74V probably benign Het
Trim37 C T 11: 87,218,257 H937Y probably benign Het
Ttc7b A G 12: 100,348,010 L46P probably damaging Het
Ttll4 T C 1: 74,696,448 V1005A probably benign Het
Ugt2b36 T C 5: 87,091,906 T207A probably damaging Het
Unc13c C T 9: 73,525,951 probably null Het
Vmn1r221 T C 13: 23,217,638 noncoding transcript Het
Vmn2r101 T C 17: 19,611,526 S595P probably damaging Het
Wnt10a T C 1: 74,803,295 L310P probably damaging Het
Yif1b G A 7: 29,244,441 A115T probably damaging Het
Zfp219 C A 14: 52,008,542 R331L possibly damaging Het
Other mutations in Gm5117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Gm5117 APN 8 31738487 exon noncoding transcript
IGL01362:Gm5117 APN 8 31737919 exon noncoding transcript
IGL01972:Gm5117 APN 8 31737759 exon noncoding transcript
IGL02100:Gm5117 APN 8 31737384 exon noncoding transcript
IGL02339:Gm5117 APN 8 31738226 exon noncoding transcript
IGL02366:Gm5117 APN 8 31737859 exon noncoding transcript
IGL02505:Gm5117 APN 8 31738316 exon noncoding transcript
IGL02698:Gm5117 APN 8 31739739 exon noncoding transcript
IGL03310:Gm5117 APN 8 31738808 exon noncoding transcript
IGL02835:Gm5117 UTSW 8 31737170 unclassified noncoding transcript
R1816:Gm5117 UTSW 8 31738958 exon noncoding transcript
R2157:Gm5117 UTSW 8 31738194 exon noncoding transcript
R2353:Gm5117 UTSW 8 31739195 exon noncoding transcript
R2404:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2408:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2409:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2510:Gm5117 UTSW 8 31738355 exon noncoding transcript
R4686:Gm5117 UTSW 8 31739256 exon noncoding transcript
R4953:Gm5117 UTSW 8 31738580 exon noncoding transcript
R5275:Gm5117 UTSW 8 31739567 exon noncoding transcript
R5329:Gm5117 UTSW 8 31737882 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGTTGTCAGCTTTCTCCAAGG -3'
(R):5'- AGAAGCCATGAATTGGATGTTG -3'

Sequencing Primer
(F):5'- GTCAGCTTTCTCCAAGGACATG -3'
(R):5'- CAGAAGTTGATGACAATGGTTTCC -3'
Posted On2016-07-06