Incidental Mutation 'R5244:Naip5'
ID401079
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 042815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5244 (G1)
Quality Score118
Status Not validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100245662 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 180 (V180I)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: V180I

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: V180I

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,411,798 G45W probably damaging Het
Abca13 C T 11: 9,275,081 T520I probably benign Het
Adamtsl3 C T 7: 82,598,069 P485L probably benign Het
Bbof1 A C 12: 84,430,073 E492A possibly damaging Het
Capn11 T C 17: 45,633,892 E483G probably damaging Het
Cbs C T 17: 31,617,160 G438D probably damaging Het
Chil6 A G 3: 106,389,974 Y284H probably damaging Het
Cops4 C A 5: 100,533,375 Q131K probably benign Het
Cul4a T C 8: 13,146,566 I740T probably damaging Het
Cyfip1 C T 7: 55,925,199 T1066I probably damaging Het
Dnah7b T C 1: 46,233,858 L2382P probably damaging Het
Ehd3 A T 17: 73,830,000 H388L probably benign Het
Fam13a G T 6: 58,953,474 Y484* probably null Het
Gm5117 A G 8: 31,738,277 noncoding transcript Het
Gulp1 G A 1: 44,788,453 D260N probably damaging Het
Hhipl1 T A 12: 108,312,134 N240K probably damaging Het
Hydin A T 8: 110,532,819 E2474D possibly damaging Het
Ifi207 C T 1: 173,729,937 V412I probably benign Het
Ighv9-4 T C 12: 114,300,251 I21V probably benign Het
Kcnh1 A T 1: 192,224,876 T79S probably benign Het
Kpna6 A G 4: 129,655,428 probably null Het
Lnpk C T 2: 74,531,888 G262D probably damaging Het
Lsm7 T C 10: 80,853,073 E66G probably benign Het
Mbd3l1 T A 9: 18,484,637 C19* probably null Het
Mfsd6l T A 11: 68,557,175 L284Q possibly damaging Het
Olfr1037 C G 2: 86,084,956 A274P probably damaging Het
Olfr1285 T A 2: 111,408,554 noncoding transcript Het
Olfr213 T A 6: 116,541,226 Y258N probably damaging Het
Olfr44 T G 9: 39,484,512 H247P probably damaging Het
Olfr531 A T 7: 140,400,138 C303S probably benign Het
Olfr694 T A 7: 106,689,189 I181F probably benign Het
Olfr837 A T 9: 19,137,851 N286I probably damaging Het
Pck1 T A 2: 173,154,863 I190N possibly damaging Het
Pfkfb3 T A 2: 11,484,849 I209F probably damaging Het
Phc1 A G 6: 122,321,979 S677P probably damaging Het
Pirb G A 7: 3,716,063 A609V probably benign Het
Plag1 A T 4: 3,903,887 S435T probably benign Het
Plscr2 C G 9: 92,291,049 L215V probably benign Het
Pnmal1 A G 7: 16,961,323 S368G probably damaging Het
Polr2b A G 5: 77,343,000 probably benign Het
Pthlh T C 6: 147,257,153 Y103C probably damaging Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rprd2 T A 3: 95,790,182 I85L possibly damaging Het
Slc27a2 T C 2: 126,578,855 V422A probably benign Het
Slc29a1 T C 17: 45,588,413 probably benign Het
Slc36a4 A T 9: 15,734,278 I334F probably benign Het
Slc4a10 T A 2: 62,288,725 S761R probably damaging Het
Spa17 T A 9: 37,611,989 M1L probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk19 A G 17: 34,832,070 L72P probably damaging Het
Trhde T C 10: 114,801,081 M74V probably benign Het
Trim37 C T 11: 87,218,257 H937Y probably benign Het
Ttc7b A G 12: 100,348,010 L46P probably damaging Het
Ttll4 T C 1: 74,696,448 V1005A probably benign Het
Ugt2b36 T C 5: 87,091,906 T207A probably damaging Het
Unc13c C T 9: 73,525,951 probably null Het
Vmn1r221 T C 13: 23,217,638 noncoding transcript Het
Vmn2r101 T C 17: 19,611,526 S595P probably damaging Het
Wnt10a T C 1: 74,803,295 L310P probably damaging Het
Yif1b G A 7: 29,244,441 A115T probably damaging Het
Zfp219 C A 14: 52,008,542 R331L possibly damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATACATGGCTGCATGTGTG -3'
(R):5'- ATGTGAGTTCCTTCAGGGCAAAG -3'

Sequencing Primer
(F):5'- ACATGGCTGCATGTGTGTGTATATG -3'
(R):5'- CCTTCAGGGCAAAGATGTTGGTAAC -3'
Posted On2016-07-06