Incidental Mutation 'R5245:Mab21l2'
ID401095
Institutional Source Beutler Lab
Gene Symbol Mab21l2
Ensembl Gene ENSMUSG00000057777
Gene Namemab-21-like 2 (C. elegans)
Synonyms
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R5245 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86545581-86548629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86547492 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 67 (E67G)
Ref Sequence ENSEMBL: ENSMUSP00000076729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077524] [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524] [ENSMUST00000212390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077524
AA Change: E67G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076729
Gene: ENSMUSG00000057777
AA Change: E67G

DomainStartEndE-ValueType
Mab-21 61 347 1.61e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107635
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191695
Predicted Effect probably benign
Transcript: ENSMUST00000192145
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194674
Predicted Effect probably benign
Transcript: ENSMUST00000194759
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195398
Predicted Effect probably benign
Transcript: ENSMUST00000195524
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212390
Meta Mutation Damage Score 0.1353 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the C. elegans MAB-21 cell fate-determining gene, a downstream target of transforming growth factor-beta signaling. It is thought that this gene may be involved in neural development. The protein encoded by this gene is primarily nuclear, although some cytoplasmic localization has been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in omphalocele and defects in ventral body wall formation resulting in death at mid-gestation. Mutants have impaired development of the retina and lens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Mab21l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Mab21l2 APN 3 86546817 missense possibly damaging 0.67
IGL02143:Mab21l2 APN 3 86547255 missense possibly damaging 0.85
IGL02570:Mab21l2 APN 3 86547224 missense possibly damaging 0.79
R0401:Mab21l2 UTSW 3 86546989 missense probably benign 0.00
R1744:Mab21l2 UTSW 3 86546904 missense possibly damaging 0.58
R2088:Mab21l2 UTSW 3 86547009 missense probably damaging 1.00
R2504:Mab21l2 UTSW 3 86547555 missense probably damaging 1.00
R3825:Mab21l2 UTSW 3 86546904 missense possibly damaging 0.58
R4361:Mab21l2 UTSW 3 86547190 missense probably damaging 1.00
R4664:Mab21l2 UTSW 3 86547504 missense probably benign
R5791:Mab21l2 UTSW 3 86546737 missense probably damaging 1.00
R5878:Mab21l2 UTSW 3 86546718 missense probably damaging 1.00
R6187:Mab21l2 UTSW 3 86547258 missense probably damaging 1.00
R6880:Mab21l2 UTSW 3 86547156 missense possibly damaging 0.71
R7021:Mab21l2 UTSW 3 86547486 missense probably benign 0.01
R8095:Mab21l2 UTSW 3 86547462 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCTACTAGTGTCTGGAAACG -3'
(R):5'- TCAGGCCAAGCTGGTTTACC -3'

Sequencing Primer
(F):5'- TACTAGTGTCTGGAAACGCGAGC -3'
(R):5'- TGGTTTACCAGCTCAATAAATACTAC -3'
Posted On2016-07-06