Incidental Mutation 'R5245:Cntfr'
ID401099
Institutional Source Beutler Lab
Gene Symbol Cntfr
Ensembl Gene ENSMUSG00000028444
Gene Nameciliary neurotrophic factor receptor
SynonymsCntfralpha
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5245 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41657498-41697089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41670879 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 95 (W95R)
Ref Sequence ENSEMBL: ENSMUSP00000100027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102961] [ENSMUST00000102962] [ENSMUST00000145379]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064443
SMART Domains Protein: ENSMUSP00000066076
Gene: ENSMUSG00000028444

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084701
SMART Domains Protein: ENSMUSP00000081751
Gene: ENSMUSG00000028444

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102961
AA Change: W95R

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100026
Gene: ENSMUSG00000028444
AA Change: W95R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102962
AA Change: W95R

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100027
Gene: ENSMUSG00000028444
AA Change: W95R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145379
SMART Domains Protein: ENSMUSP00000115631
Gene: ENSMUSG00000028444

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IGc2 37 60 2e-9 BLAST
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the ciliary neurotrophic factor (CNTF) receptor that triggers the assembly of a trimolecular complex upon binding to CNTF, and initiate a downstream signaling process. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-linked cell surface protein. Mice lacking the encoded protein die shortly after birth and exhibit a reduction of motoneuron number at birth. The transgenic disruption of this gene specifically in the skeletal muscle followed by a peripheral nerve lesion impairs motor neuron axonal regeneration across the lesion site. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant animals exhibit a significant reduction in the number of motor neurons. Neonatal mutants fail to suckle and die within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Cntfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1215:Cntfr UTSW 4 41662064 missense probably damaging 1.00
R1635:Cntfr UTSW 4 41658816 missense probably damaging 1.00
R1795:Cntfr UTSW 4 41670841 critical splice donor site probably null
R2115:Cntfr UTSW 4 41663534 splice site probably null
R2437:Cntfr UTSW 4 41671035 missense probably damaging 0.99
R4056:Cntfr UTSW 4 41658900 missense probably damaging 0.99
R4770:Cntfr UTSW 4 41663282 missense possibly damaging 0.57
R5346:Cntfr UTSW 4 41675042 nonsense probably null
R5436:Cntfr UTSW 4 41663322 missense probably damaging 0.98
R5535:Cntfr UTSW 4 41663216 missense probably benign 0.44
R6275:Cntfr UTSW 4 41663216 missense possibly damaging 0.89
R6749:Cntfr UTSW 4 41663232 missense possibly damaging 0.47
R7626:Cntfr UTSW 4 41662013 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCACTGAGCAAGATGAGACTC -3'
(R):5'- ACGTGCAGTATGAGCGTCTG -3'

Sequencing Primer
(F):5'- CAAGATGAGACTCAAGAGGTCC -3'
(R):5'- TCTGGGCGCAGATGTGAC -3'
Posted On2016-07-06