Incidental Mutation 'R5245:Hrc'
ID401110
Institutional Source Beutler Lab
Gene Symbol Hrc
Ensembl Gene ENSMUSG00000038239
Gene Namehistidine rich calcium binding protein
Synonyms
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5245 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45335290-45338974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45335431 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 2 (G2D)
Ref Sequence ENSEMBL: ENSMUSP00000147299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000042194] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000210541] [ENSMUST00000211067] [ENSMUST00000211327] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085351
AA Change: G2D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239
AA Change: G2D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210844
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211098
Predicted Effect probably damaging
Transcript: ENSMUST00000211327
AA Change: G2D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211411
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Meta Mutation Damage Score 0.2525 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired weight gain and weight loss around 1 year of age and increased susceptibility to induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Hrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03379:Hrc APN 7 45337255 missense probably benign 0.27
BB004:Hrc UTSW 7 45336053 missense possibly damaging 0.53
BB014:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R0017:Hrc UTSW 7 45336370 missense possibly damaging 0.71
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0310:Hrc UTSW 7 45336497 missense probably benign
R0436:Hrc UTSW 7 45336133 missense possibly damaging 0.53
R0534:Hrc UTSW 7 45337235 unclassified probably benign
R1230:Hrc UTSW 7 45336463 missense possibly damaging 0.85
R1808:Hrc UTSW 7 45336778 missense probably damaging 0.99
R1975:Hrc UTSW 7 45336214 missense probably damaging 0.98
R1977:Hrc UTSW 7 45336214 missense probably damaging 0.98
R2258:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R2260:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R3551:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R3552:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R4169:Hrc UTSW 7 45336757 missense probably benign 0.00
R5085:Hrc UTSW 7 45337021 missense probably damaging 0.99
R5204:Hrc UTSW 7 45335704 missense possibly damaging 0.96
R5215:Hrc UTSW 7 45336091 missense probably damaging 0.99
R5390:Hrc UTSW 7 45335485 missense probably damaging 0.96
R5432:Hrc UTSW 7 45336861 missense possibly damaging 0.72
R5756:Hrc UTSW 7 45336706 missense possibly damaging 0.85
R5761:Hrc UTSW 7 45336601 unclassified probably null
R5905:Hrc UTSW 7 45336234 missense probably damaging 0.99
R6144:Hrc UTSW 7 45336733 missense possibly damaging 0.86
R6684:Hrc UTSW 7 45336532 missense possibly damaging 0.53
R6699:Hrc UTSW 7 45335695 missense possibly damaging 0.85
R6809:Hrc UTSW 7 45336379 missense probably benign
R6887:Hrc UTSW 7 45335664 missense probably benign 0.18
R7178:Hrc UTSW 7 45336261 missense possibly damaging 0.53
R7208:Hrc UTSW 7 45336565 missense possibly damaging 0.53
R7258:Hrc UTSW 7 45336296 missense possibly damaging 0.70
R7310:Hrc UTSW 7 45335803 nonsense probably null
R7456:Hrc UTSW 7 45336896 missense possibly damaging 0.83
R7525:Hrc UTSW 7 45336379 missense probably benign
R7673:Hrc UTSW 7 45337234 missense probably benign 0.00
R7734:Hrc UTSW 7 45336676 missense probably benign 0.06
R7927:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R8080:Hrc UTSW 7 45336838 missense probably damaging 0.96
Z1177:Hrc UTSW 7 45336970 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATTGGTCCAGCAGTGGGAAG -3'
(R):5'- TGGTGACCAAACTCAGTTGATAGG -3'

Sequencing Primer
(F):5'- AGCTGCAAAGGGGACATCCTC -3'
(R):5'- CAAACTCAGTTGATAGGTCCTCTGAG -3'
Posted On2016-07-06